Gene detail

Detail information of MD01G1055100 Annotation

Gene ID	Annotation
MD01G1055100	adenosine deaminases

Network

Network Category	Global Network	Conditional network (different tissues and developmental stages)
Coexpression Positive	Top300 PCC genelist	Top300 PCC genelist
Coexpression Negative	Top300 PCC genelist	Top300 PCC genelist

Functional module

Method	Module ID	Function Annotation
Co-expression network	CFinderM0226	mitochondrial mRNA modification tRNA-specific adenosine deaminase 1 [EC:3.5.4.34] mitochondrion cytidine to uridine editing adenosine deaminase activity

Gene structure and chromatin state

more details in UCSC

details of chromatin state

Location

Gene	Type	Chr	Start	End	Strand
MD01G1055100	mRNA	Chr01	15956369	15967398	+

Sequences

CDS:

MD01G1055100

ATGGCGTCGACTCCCTGCTCCGAAACGCCGTCGTCTCCTTCTCGTTCTTCCTCAGAAGTAGCATGGGGCACTAAGGTCTCAGACAAAGTGTTCGCACTCTACAACTCCCTCCCCAAGAAAGGCAAGCCTCAGGGCCGCGAAGTCACCGTCTTGGCCGCTTTCCTCCTCTCCTCCCCTTCTCAAGAGCTTGAAGTCGTCGTATTGGGAACTGGGACCAAATGCATAGGGCGGTCACTGAGGAGTCCCCACGGCGACGTCGTCAACGATTCCCACGCCGAGATTGTAGCTCGAAGATCTTTACTCAGGTTCTTCTATGCACAGATTCAATGTCTTTCTCAAATTTGTAGTAAGAAGAGTGATGACGATGAAAGCACGCAGATTCAAAACTGTGATGCTAAAAACTTGATTTTTGAATTGGACCCGGGTGGTGATGGCGAAAGAAAATACACAATGAAGAAGGATTGGAATTTGCACTTGTACATATCGCAACTGCCATGTGGGGTTGCTTCTCCGAGTTCACTATTGTCTCCTCCAAAACATACTGCACCGAGAGAACGGGGTTCATCTTTGGACGAGCTTAATAATGTCATCGCAGGAGAGGCTCCACCAAAGACTAATGGTAGTGATGCTTCACAACTAATTGGCTTGGTACAAAGAAAGCCTGGTCGCGGTGATACAACATTATCAGTTAGTTGCTCTGACAAGATAGCCCGCTGGAATGTTGTTGGAGTTCAAGGATCTTTGCTTTCATTCTTTCTGCAACCTGTATACCTTTCTTCGGTCACTGTTGGGCAATCCCGAAACTATAAAATGGTTTCTGTGGTTGATCAATTGAAACAAGCGTTGCACGATCGCGTTCAACCATTATCAAATGAGCTGATGAGTCCTTTCCAAGTGAACCAGCCATTAATATGGGCAGCTCCAACACCACAAAAGGAATTTCAGCATTCTGAGACAGCTTTGACCACTTTAACATGCGGGTATTCGATATGTTGGAATAAATCTGGTCTGCATGAAGTCATTCTTGGAACCACCGGAAGAAAGCAAGGAACTGCTGCGAAAGGGGCACATTATCCATCAACTGAGTCATTATTATGCAAAAAGCGGCTGTTGGAAATTTTCTTGTCTCTAAGACATGAATGCCCTATCAAAATCCCAGTGAATGAGATGTCTTATCAAGAAATCAAGGAAAGGGCACAGGAATACAATTTAACCTCAAAACTTCTAAAAACAAGACCTCCCTTTAGTAATTGGCCATTGAAACCCCCACATTTTGAGGCATTCGCTGCCATGATACAGAATCAGGACATCAGTGGTTAGAAAATGACAGTTTCTGCACTCCAATGGCATAATACCGATGGAGTGGTTTGTGTTCGGACCAACAAAGGAGGAGTGAGGTCATTGTGTCACCCCTCGTTGCACCTTTCTGCATATCTCTTCTTGAAATAGCAAACTCGCAGTTAATATTTTGGTTCTATTGCTTATTACTGTGAATTGTGTGAACGCTTCTGTCTGCAGCAGCTGTGCAGCCTTTTTCGCAAACAACTCTTTAGTGCCAAACTGGATGAGAGTTTGATCCTCTGATTTTTTATAACTGATCTTCTTGTTGACTAGAAAACTCCTGGAAGTGTTAGAATGGCTATTTGAACGGGCATGAATATTAGCAGAACTTAAGAGCTGGAAGTGTATGTTATGCCGAAGGCCCGAAGAGCTCTGATCTGTATTTTTTGCTGACATGTCAAAACTACACGCCCAAGGCCGGCAAAGCTGTGATTAAGGAACCGAAATATGAGTGCCTACTGCCTAAGGGGGGCCCAAAGAAGCTAGGAATTTTGTAGGCTACGTACTTGTTACTCTTTAGATTCACAAGTCATAAAACCCCTTTGACTTACTTTTAAGTTCCACACGGCAATTGTTGTGTTGGTGAGCCTAATTTGCATCCCCAGTCTGCACCTAGCGTGTACATTTTGCAGAAGCTAGAAAACAAATTTAGCAATTTTGATAACCATTTTGTTTTTAGCGTTATGTTT

Protein:

Gene family

Gene family	Subfamily
--	--

Orthologous genes

Species	Gene ID	Score of Inparanoid	Annotation
Arabidopsis thaliana	AT1G01760.1	1	AtTAD1;TAD1\|ortholog of yeast Tad1
Prunus persica	Prupe.2G164800.3.p	1	adenosine deaminases;RNA binding;RNA binding;adenosine deaminases
Prunus persica	Prupe.2G164800.1.p	1	adenosine deaminases;RNA binding;RNA binding;adenosine deaminases
Pyrus communis	PCP025402.1	1	-
Pyrus x bretschneideri	Pbr041635.2	1	-
Rosa multiflora	Rmu_sc0004632.1_g000008.1	1	-
Fragaria vesca	mrna19063.1	1	adenosine deaminases;RNA binding;RNA binding;adenosine deaminases
Vitis vinifera	GSVIVT01026870001	1	adenosine deaminases;RNA binding;RNA binding;adenosine deaminases
Solanum lycopersicum	Solyc05g048810.2.1	1	adenosine deaminases;RNA binding;RNA binding;adenosine deaminases
Populus trichocarpa	Potri.014G081400.1	1	adenosine deaminases;RNA binding;RNA binding;adenosine deaminases
Oryza sativa	LOC_Os04g58690.6	1	"tRNA-specific adenosine deaminase 1, putative, expressed"
Zea mays	GRMZM2G042599_P01	1	adenosine deaminases;RNA binding;RNA binding;adenosine deaminases

Gene Ontology

GO term	Description	Category
GO:0004000	adenosine deaminase activity	molecular_function
GO:0003723	RNA binding	molecular_function
GO:0006396	RNA processing	biological_process

KEGG

KO	Description	Enzyme
K15440	tRNA-specific adenosine deaminase 1	EC:3.5.4.34

Pfam domain

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Expression pattern

SRA Experiment	Tissue	Stress	Stage	FPKM
SRR768136	whole seedling	no	seedling	1.08775
SRR5252888	dormant buds	no	dormant buds(0 month)	1.95028
SRR5252889	dormant buds	no	dormant buds(0 month)	2.35343
SRR5252886	dormant buds	no	dormant buds(1 months)	1.23872
SRR5252887	dormant buds	no	dormant buds(1 months)	1.75536
SRR5252884	dormant buds	no	dormant buds(2 months)	2.01488
SRR5252882	dormant buds	no	dormant buds(3 months)	1.75723
SRR5252883	dormant buds	no	dormant buds(3 months)	1.05314
SRR5252880	dormant buds	no	dormant buds(4 months)	1.9291
SRR5252881	dormant buds	no	dormant buds(4 months)	2.09255
SRR5252878	bud break	no	bud break	1.92144
SRR5252879	bud break	no	bud break	1.88855
SRR3744766	flower	no	mature	0.713697
SRR3744767	flower	no	mature	0.959943
SRR3744768	flower	no	mature	0.994754
SRR6308190	stigmas	no	open flowers	0.700289
SRR6308181	styles	no	open flowers	0.542363
SRR6308188	filaments	no	open flowers	0
SRR6308187	anthers	no	buds 1-3 days prior to flower opening	0.186723
SRR6308192	pollen	no	open flowers	0
SRR6308191	petals	no	open flowers	0.850568
SRR6308194	sepals	no	open flowers	0.524543
SRR6308193	receptacles	no	open flowers	0.896463
SRR6308189	ovaries	no	open flowers	0.923032
SRR3384922	fruit	no	1 week after full bloom	1.39826
SRR3384921	fruit	no	2 week after full bloom	0.801282
SRR3384920	fruit	no	3 week after full bloom	0.705543
SRR3384919	fruit	no	4 week after full bloom	0.760454
SRR3384923	fruit	no	5 week after full bloom	0.550998
SRR3384918	fruit	no	6 week after full bloom	0.613375
SRR3384917	fruit	no	8 week after full bloom	0.442778
SRR3384916	fruit	no	10 week after full bloom	0.754956
SRR3384915	fruit	no	12 week after full bloom	0.510432
SRR3384914	fruit	no	14 week after full bloom	0.453792
SRR3384913	fruit	no	16 week after full bloom	0.534491
SRR3384912	fruit	no	18 week after full bloom	0.547192
SRR3384911	fruit	no	19 week after full bloom	0.17494
SRR3384910	fruit	no	20 week after full bloom	0.547894
SRR768128	whole fruit	no	25 days post anthesis	0.891838
SRR768129	whole fruit	no	35 days post anthesis	0.816142
SRR768130	whole fruit	no	60 days post anthesis	0.547336
SRR768131	whole fruit	no	87 days post anthesis	0.892633
SRR7343308	immature fruit flesh	no	immature	1.45721
SRR7343309	immature fruit flesh	no	immature	1.21144
SRR6320494	ripe fruit flesh	no	mature	0.698626
SRR5405143	ripe fruit peel	no	mature	0
SRR6320572	ripe fruit peel	no	mature	0.809946
SRR7403504	fruit	uninfected	mature	0.571255
SRR7403506	fruit	uninfected	mature	0.531034
SRR7403507	fruit	uninfected	mature	0.573194
SRR7403500	fruit	infected with penicillium expansum	mature	0.354345
SRR7403501	fruit	infected with penicillium expansum	mature	0.17528
SRR7403508	fruit	infected with penicillium expansum	mature	0
SRR7403502	fruit	infected with penicillium expansum	mature	0.195386
SRR7403503	fruit	infected with penicillium expansum	mature	0.218231
SRR7403505	fruit	infected with penicillium expansum	mature	0.245204
SRR1613973	Central seeds	no	20DAPF	1.26618
SRR1613974	Central seeds	no	20DAPF	1.57087
SRR1613975	Central seeds	no	20DAPF	1.4906
SRR1613976	Lateral seeds	no	20DAPF	1.08548
SRR1613977	Lateral seeds	no	20DAPF	1.11262
SRR1613978	Lateral seeds	no	20DAPF	1.22125
SRR3744786	stem	no	mature	0.960184
SRR3744787	stem	no	mature	1.09868
SRR3744772	stem	no	mature	1.07724
SRX765691	seedling shoot apex	no	4-6 week old seedling	1.56879
SRX765683	tree shoot apex	no	Adult (tree), new shoot has 10-12 visible leaves	1.17858
SRR1089478	leaf	Virus-free	plantlets	1.34609
SRR1089477	leaf	ASGV-infected	plantlets	1.35125
SRR767660	leaf	uninfected	fully developed	0.241008
SRR767669	leaf	2 days post infection by Venturia inaequalis	fully developed	9.64063
SRR767670	leaf	4 days post infection by Venturia inaequalis	fully developed	0.989648
SRR767671	leaf	6 days post infection by Venturia inaequalis	fully developed	0
SRR767672	leaf	8 days post infection by Venturia inaequalis	fully developed	0
SRR767673	leaf	10 days post infection by Venturia inaequalis	fully developed	0.209295
SRR767674	leaf	12 days post infection by Venturia inaequalis	fully developed	0.24348
SRR768127	leaf	14 days post infection by Venturia inaequalis	fully developed	0.614541
SRR6308182	young leaf	no	immature leaves	2.35937
SRR3744769	leaf	no	mature	0.828037
SRR3744770	leaf	no	mature	1.09265
SRR3744771	leaf	no	mature	1.21476
SRR5405145	leaf	no	mature	0.704152
SRR6320561	leaf	no	mature	0.727314