Gene detail

Detail information of MD03G1131000 Annotation

Gene ID	Annotation
MD03G1131000	magnesium (Mg) transporter 10

Network

Network Category	Global Network	Conditional network (different tissues and developmental stages)
Coexpression Positive	Top300 PCC genelist	Top300 PCC genelist
Coexpression Negative	Top300 PCC genelist	Top300 PCC genelist

Functional module

Method	Module ID	Function Annotation
Co-expression network	CFinderM0551	chloroplast thylakoid membrane chloroplast envelope somatic embryogenesis receptor kinase 1 [EC:2.7.10.1 2.7.11.1] YidC/Oxa1 family membrane protein insertase Leucine Rich Repeat Kinase II & X inorganic diphosphate transmembrane transporter activity

Gene structure and chromatin state

more details in UCSC

details of chromatin state

Location

Gene	Type	Chr	Start	End	Strand
MD03G1131000	mRNA	Chr03	12908073	12913524	-

Sequences

CDS:

MD03G1131000

TCCATTTGCACGTTACAGATATTACCCAACTCCTCCACCCTACATGATCGCAGCCAGAGCTCTTCGACTTTGCAATGGCTCTGACTCCATGGCCGTACTTCCTCCAGCTCCCACTCCACTCCTCGCCCCACTCCGCTCAGCTCTTCTACTCCCAATCGCGAAAGGCCGAGGCCTCTCTCGTCTCTCCGATTCCAGTCAAGCTCTCCGTCTCGGTCTCGCGGAGACCCAAGTGCTTTAGATCGGCCACCGAGGAGGACCGGTTCAGCGACCCCGAAACCATCTCCGATGACGAAGCTAGACCCCACGACGAAGTTCCGGTCAACAGCCGACATCAAAGGACGACGACGGCGGCGACGAGTGGTGGCTCGGGTAGGGTTGCGATGTCGTCTGCCAGTGATTCTTTGCTCGGAATTCGCGAGCCGGTCTACGAGGTGGAAGAAGTGAAGGCTAATGGGACGATATCTGTTAGAAAAATAAACAGACGTCAGCTGCTGAAGTCAAGTGGTCTTCGTCCGCGTGATATTCGGAGTGTTGATCCTTCATTGTTTCTCACAAATTCGATGCCTTCGTTGCTGGTCCGGGAGCATGCTATTCTGTTGAATCTAGGCTCATTACGCGCAATTGCAATGCAAGAGCGTGTCCTTATATTTGACTACAACAATACAGGAAGCAGAGCTTTCATAGAAGCATTGTTGCCTCGACTAAACCCCAAAAATATGAATGGAGGACCATCTATGCCATTTGAGCTCGAGGTTGTTGAAGCAGCATTGCTCTCAAGAATACAGCGTTTAGAACAAAGACTAATGTATTTAGAACCTCGTGTTCAAAAGTTACTCAGTGTTTTGCCGAACCGGTTAACTGCTGACATACTGGAAGAGCTTCGTATTAGCAAGCAAACCTTGGTTGAATTGGGTTCGAGGGCAGGGGCTTTCAGGCAAGTGCTCTTTGATCTGTTAGAGGATCCCCATGAAATACGCCGTATATGCATTATGGGGAGAAATTGTACACTCAAGAAGATAAATGATGACATGGAATGTTCTGTTCCTTTAGAGAAGCAGATTGCTGAAGAAGAGGAGGAAGAAATTGAGATGCTCTTGGAAAATTATCTTCAACGGTGTGAATCTTGTCATGGCCAGGCTGAAAGGCTTCTCGATTCTGCTAAAGAAATGGAAGATTCTATAGCTGTCAATTTGAGTTCTCGGAGGCTTGAGGTTAGCAGGGTGGAATTACTACTCCAGGTTGGGACGTTTTGTGTGGCACTTGGCGCTCTGGTTGCAGGTATTTTTGGCATGAACTTGAGGTCCTACCTCGAAGAACATGTGTTCGCATTTTGGTTTACAACAGCAGGGATACTAGTCGGCGCCGTCTTCGGATTTTTTCTTGTCTACTCTTATCTCAGGACACGGAAAATACTGTAAATGTAAAGTGATTCAGTATAGGTGATTTCGGAGGTGATGAACAAACAGTCAGCTGCCAAACACATTGATATGATTGTACTGTATTTCAATTATTTCATCACTGCGGCTTGGTAACGCGAGTTGAATCCGTTAGGCTTTAGCTCTAGTATATGCAACAAGTAGCGGTGATTAGTGTTCATGGCCCTGTAATATTTTGGCCAAGCTGGATGCTGGATTGTATAAGTGCCCCACTGCCCACGCCTTACAGAAGTAAGAAACAAAGAATGTACACCCAAAAGAACGATATATTCACACATTACAAACATAAATCTTTAAATGAAACCTAGTCTGGTGAAAGTTTGATACATCGACCCTTCCATAGAACCGTCAAATTGGAAATAACGAAATATTTGATAAGAATGTTTGTAATCAAAGACAAAATGTGCTTCAGAGATGTACTTAGAAATTTGAGCACGATTGAGAAAGATACTAGAGCAGACTACTGGTAAGCACTAATCAAAGCCGCATCCCCGAAACTCGAAATGGATTAACAAATGAATATGGAAAACCAACAAAAGCTCAATGCATTGGACAAAAAAGGAAAGAAGGAAAAGGAAGAAGAGAAAAACACAGCTCTACGGTAAAAGAACAAAACAAAGGGGTGTGATATTCACACACTCCATTTTACTTTTCACACACCCTTCTAATTTTCGGCCGTCGAATCGGATGAATTGAAGAAAATCAACGGATAGAAATTAACAAGGGGTGTGTAAGAAGTAAAATGGGATGTGTGGATAGCACACCCCTAAAATTGCATAAAACATGGAAAAG

Protein:

Gene family

Gene family	Subfamily
Transporter family	MIT

Orthologous genes

Species	Gene ID	Score of Inparanoid	Annotation
Arabidopsis thaliana	AT5G22830.1	1	ATMGT10;GMN10;MGT10;MGT10;MRS2-11\|magnesium (Mg) transporter 10;;MAGNESIUM TRANSPORTER 10
Pyrus communis	PCP005890.1	1	-
Rosa multiflora	Rmu_sc0014108.1_g000002.1	1	-
Rubus occidentalis	Ro06_G13167	1	-
Fragaria vesca	mrna14480.1	1	magnesium (Mg) transporter 10
Vitis vinifera	GSVIVT01031426001	1	magnesium (Mg) transporter 10
Solanum lycopersicum	Solyc11g066660.1.1	1	magnesium (Mg) transporter 10
Populus trichocarpa	Potri.009G151400.1	1	magnesium (Mg) transporter 10
Nicotiana benthamiana	Niben101Scf06295g03003.1	1	Magnesium transporter MRS2-7
Oryza sativa	LOC_Os03g48000.1	1	"CorA-like magnesium transporter protein, putative, expressed"
Zea mays	GRMZM2G420436_P01	1	magnesium (Mg) transporter 10

Gene Ontology

GO term	Description	Category
GO:0016020	membrane	cellular component
GO:0015693	magnesium ion transport	biological_process
GO:0055085	transmembrane transport	biological_process
GO:0015095	magnesium ion transmembrane transporter activity	molecular_function

KEGG

KO	Description	Enzyme
--	--	--

Pfam domain

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Expression pattern

SRA Experiment	Tissue	Stress	Stage	FPKM
SRR768136	whole seedling	no	seedling	8.91679
SRR5252888	dormant buds	no	dormant buds(0 month)	3.29723
SRR5252889	dormant buds	no	dormant buds(0 month)	5.05044
SRR5252886	dormant buds	no	dormant buds(1 months)	3.2577
SRR5252887	dormant buds	no	dormant buds(1 months)	3.0666
SRR5252884	dormant buds	no	dormant buds(2 months)	4.89737
SRR5252882	dormant buds	no	dormant buds(3 months)	4.43646
SRR5252883	dormant buds	no	dormant buds(3 months)	3.19408
SRR5252880	dormant buds	no	dormant buds(4 months)	3.7951
SRR5252881	dormant buds	no	dormant buds(4 months)	3.51034
SRR5252878	bud break	no	bud break	5.19755
SRR5252879	bud break	no	bud break	3.97333
SRR3744766	flower	no	mature	1.74629
SRR3744767	flower	no	mature	1.41102
SRR3744768	flower	no	mature	1.88996
SRR6308190	stigmas	no	open flowers	1.20136
SRR6308181	styles	no	open flowers	1.30618
SRR6308188	filaments	no	open flowers	2.77495
SRR6308187	anthers	no	buds 1-3 days prior to flower opening	1.77062
SRR6308192	pollen	no	open flowers	0.478729
SRR6308191	petals	no	open flowers	3.28175
SRR6308194	sepals	no	open flowers	7.44314
SRR6308193	receptacles	no	open flowers	2.69836
SRR6308189	ovaries	no	open flowers	1.44779
SRR3384922	fruit	no	1 week after full bloom	2.9665
SRR3384921	fruit	no	2 week after full bloom	1.84635
SRR3384920	fruit	no	3 week after full bloom	2.15588
SRR3384919	fruit	no	4 week after full bloom	2.57943
SRR3384923	fruit	no	5 week after full bloom	3.85031
SRR3384918	fruit	no	6 week after full bloom	1.69374
SRR3384917	fruit	no	8 week after full bloom	2.79465
SRR3384916	fruit	no	10 week after full bloom	3.56565
SRR3384915	fruit	no	12 week after full bloom	4.18049
SRR3384914	fruit	no	14 week after full bloom	3.45932
SRR3384913	fruit	no	16 week after full bloom	4.68787
SRR3384912	fruit	no	18 week after full bloom	4.76936
SRR3384911	fruit	no	19 week after full bloom	7.45308
SRR3384910	fruit	no	20 week after full bloom	6.26782
SRR768128	whole fruit	no	25 days post anthesis	3.53045
SRR768129	whole fruit	no	35 days post anthesis	1.17781
SRR768130	whole fruit	no	60 days post anthesis	1.89243
SRR768131	whole fruit	no	87 days post anthesis	1.85797
SRR7343308	immature fruit flesh	no	immature	4.16019
SRR7343309	immature fruit flesh	no	immature	3.05779
SRR6320494	ripe fruit flesh	no	mature	6.93397
SRR5405143	ripe fruit peel	no	mature	3.78239
SRR6320572	ripe fruit peel	no	mature	2.92598
SRR7403504	fruit	uninfected	mature	6.6152
SRR7403506	fruit	uninfected	mature	6.96623
SRR7403507	fruit	uninfected	mature	6.92714
SRR7403500	fruit	infected with penicillium expansum	mature	0.692415
SRR7403501	fruit	infected with penicillium expansum	mature	1.34369
SRR7403508	fruit	infected with penicillium expansum	mature	1.65241
SRR7403502	fruit	infected with penicillium expansum	mature	1.71809
SRR7403503	fruit	infected with penicillium expansum	mature	1.32852
SRR7403505	fruit	infected with penicillium expansum	mature	1.10572
SRR1613973	Central seeds	no	20DAPF	1.69683
SRR1613974	Central seeds	no	20DAPF	1.32577
SRR1613975	Central seeds	no	20DAPF	1.64477
SRR1613976	Lateral seeds	no	20DAPF	1.56687
SRR1613977	Lateral seeds	no	20DAPF	1.31943
SRR1613978	Lateral seeds	no	20DAPF	1.45938
SRR3744786	stem	no	mature	1.06777
SRR3744787	stem	no	mature	0.972213
SRR3744772	stem	no	mature	1.13687
SRX765691	seedling shoot apex	no	4-6 week old seedling	3.04029
SRX765683	tree shoot apex	no	Adult (tree), new shoot has 10-12 visible leaves	3.30658
SRR1089478	leaf	Virus-free	plantlets	2.85744
SRR1089477	leaf	ASGV-infected	plantlets	3.98968
SRR767660	leaf	uninfected	fully developed	5.21884
SRR767669	leaf	2 days post infection by Venturia inaequalis	fully developed	11.6856
SRR767670	leaf	4 days post infection by Venturia inaequalis	fully developed	7.09581
SRR767671	leaf	6 days post infection by Venturia inaequalis	fully developed	5.61755
SRR767672	leaf	8 days post infection by Venturia inaequalis	fully developed	14.5513
SRR767673	leaf	10 days post infection by Venturia inaequalis	fully developed	4.72288
SRR767674	leaf	12 days post infection by Venturia inaequalis	fully developed	6.59459
SRR768127	leaf	14 days post infection by Venturia inaequalis	fully developed	6.37627
SRR6308182	young leaf	no	immature leaves	3.39993
SRR3744769	leaf	no	mature	1.92476
SRR3744770	leaf	no	mature	2.38545
SRR3744771	leaf	no	mature	2.59802
SRR5405145	leaf	no	mature	30.1016
SRR6320561	leaf	no	mature	16.6934