Gene detail

Detail information of MD06G1175800 Annotation

Gene ID	Annotation
MD06G1175800	polygalacturonase 2

Network

Network Category	Global Network	Conditional network (different tissues and developmental stages)
Coexpression Positive	Top300 PCC genelist	Top300 PCC genelist
Coexpression Negative	Top300 PCC genelist	Top300 PCC genelist

Functional module

Method	Module ID	Function Annotation
Co-expression network	CFinderM0774	polarity specification of adaxial/abaxial axis maintenance of shoot apical meristem identity leaf morphogenesis gamete generation regulation of cell proliferation RNA interference cell wall macromolecule metabolic process flower morphogenesis xylem development xylem and phloem pattern formation regulation of organ morphogenesis plant-type cell wall organization regulation of cell adhesion methylation-dependent chromatin silencing meristem initiation determination of bilateral symmetry regulation of cell growth regulation of meristem growth inflorescence morphogenesis DNA methylation transpiration

Gene structure and chromatin state

more details in UCSC

details of chromatin state

Location

Gene	Type	Chr	Start	End	Strand
MD06G1175800	mRNA	Chr06	31527995	31530198	+

Sequences

CDS:

MD06G1175800

CTCTCTCTCTCTCTCTCTTCCCTCCACAACATGAAAATCTTCCTCTTCTTCTTCTTCTTATTATTCGCACTTTTCCAGGTCTCAGTAGCGAGCACAAGCAATGAAACTACAAACAACCCTTTCACTCCCAAAGCCTCACTCAACCGCTATTGGGACACCCACATTTCCAACAACCTCCCAAAACCCGCCTTCCTCTTCGCCAAAGCTTCCCAACTCGACCCAGTCAACTCAACGATTCTCACCAAACTCGCCGCTCAAAACTCACTGTCCTCCCACTTCACCTCCTTCTGCTCCCTAGCCAACCTCTGCTGCTCCTTCGACTCCTCCGCCGAAACCCACCAACAAGACATCGCCACCCGCCACCCCAAAAACGCAAACTTCGCCGTCTACGCCGACAAGAACTTCGCCAACTACGGCTCCTCCCAACTCGGTGGAGTCGACTCGTTCAAGAACTACTCGGAAGAGTTGAACTCGCCCCGCGACTCGTTCAAGAAGTACAGCAAGGGCTCCCACTCGCACTTGGAGAAGTTCACGTCCTACGCCCACGATGCCAACGTCGCAAACTCCAACTTCACCAGCTACGGCGCCGACTCGGGCGGCGGTTCGGGCGAGTTCACCAGCTACGACGACCGAGTCAACGTCCCTAGCCTCGGATTCACATCCTACGACTCGAACGCCAACGACCACCGTCTCTCCTTCACCGGGTACGGCCACGACACCAACTCGGGCTCTGAATCCTTCACCAGCTACGGAAAATCCGGCAATTCTAACCCGAACCAGTTCACCAGGTACGCTGAAGGTTCGAACATAATAGGGTCGGGTTTCACGGGTTACGGAGAGTCCGGGAACGGCCAAAACGATTCGTTTACAGGGTATGGGCAATCTGGTAATAACCCACATAACAATTTCAAGAGCTACGGCGCCGGCGGGAATGCCGGGCTCGATGGGTTCTCCAATTACCGGAGCTGGGCGAATGTCGGCGACGATACGTTTCAGTCGTACGCGAGAAATTCAAATTCCGGGAAAGTGAGATTCTCGAATTACGGGAAATCGTTCAACCCCGGAAACGACTCGTTCAAAGAGTACGGAGCCGGGTCGAAGGGTCGGACCACCGTCGGGTTCAAAACGTACGGTTTGGGTCGGAGTTTCAAAGAGTATGCCAAAAATGGCGTCACTTTTGCAGAGTATAACGATTTGAGCAGCGTAGGAACCCATTCGACTGAAAAGGAGTCTAGTGGCAGTGCTGTAAATAGGTGGGTTGAGCCCGGCAAGTTCTTCAGGGAATCAATGTTGAGGCAGGGGAATGTAATGGTGATGCCCGACATTAGGGACCGAATGCCGGAAAGGTCGTTTTTACCCCGGGGGATTTTGTCGAAATTACCTTTTTCGACGTTGAGGATGTCGGAGATTAAGGAGATATTTCACGCACCGGAGAACTCCGCCATGGAGCGCGTGCTGACTAACGCGCTGGCCGAATGTGAGAGGGATCCGAGCCCGGGCGAAACCAAGCGGTGCGTGGGGTCGGTTGAGGACATGATTGACTTTGCAGTCTCGGTCCTCGACCGCAATGTGGTGGTCCGGACCACGAAAAATGTGAGCGGGTCAAAGCAGAAGGTGATGATCGGAGCGGTCAGCGGAATCAACAGCGGAAATATAACCAAATCGGTTTCGTGTCATCAAAGTTTGTATCCCTACTTACTGTATTACTGCCACTCCGTGCCTAGGGTTAGGGTTTATGAGGCTGATATCCTTGATGTGGAGAGTAAGAGCAAGATCAACCACGGTGTTGCCATTTGTCACATGGACACGTCATCGTGGAGTCCGGGACATGGTGCATTCGTGGCACTGGGGTCCAGTCCGGGAAAAATTGAAGTCTGCCACTGGATATTCGAGAACGACATGACATGGACAATTGCGGATTAAGGACTGACACTGTTTTGTCTTCCATGTTTCACTGAGATTTATTGTGGTAATTAAGAAGCTTTTTGGTTCGGTGATTTCATTGTTTTATATATGGTTAAAGTTTGGGAGTTTGTTAGTTCAATGTCTGCTTTTCTTTTGCTTTTAATTT

Protein:

Gene family

Gene family	Subfamily
--	--

Orthologous genes

Species	Gene ID	Score of Inparanoid	Annotation
Prunus persica	Prupe.5G175100.1.p	1	polygalacturonase 2
Pyrus communis	PCP039168.1	1	-
Rosa multiflora	Rmu_sc0001436.1_g000011.1	1	-
Rubus occidentalis	Ro05_G12151	1	-
Fragaria vesca	mrna32173.1	1	polygalacturonase 2
Vitis vinifera	GSVIVT01007771001	1	polygalacturonase 2
Solanum lycopersicum	Solyc03g114240.2.1	1	polygalacturonase 2
Populus trichocarpa	Potri.012G079200.1	1	polygalacturonase 2
Nicotiana benthamiana	Niben101Scf04801g01025.1	1	Polygalacturonase-1 non-catalytic subunit beta

Gene Ontology

GO term	Description	Category
--	--	--

KEGG

KO	Description	Enzyme
--	--	--

Pfam domain

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Expression pattern

SRA Experiment	Tissue	Stress	Stage	FPKM
SRR768136	whole seedling	no	seedling	0.866717
SRR5252888	dormant buds	no	dormant buds(0 month)	0.953608
SRR5252889	dormant buds	no	dormant buds(0 month)	2.07132
SRR5252886	dormant buds	no	dormant buds(1 months)	3.73505
SRR5252887	dormant buds	no	dormant buds(1 months)	2.30668
SRR5252884	dormant buds	no	dormant buds(2 months)	2.14172
SRR5252882	dormant buds	no	dormant buds(3 months)	3.17909
SRR5252883	dormant buds	no	dormant buds(3 months)	1.54483
SRR5252880	dormant buds	no	dormant buds(4 months)	2.744
SRR5252881	dormant buds	no	dormant buds(4 months)	4.04511
SRR5252878	bud break	no	bud break	5.80785
SRR5252879	bud break	no	bud break	6.53499
SRR3744766	flower	no	mature	0.0536683
SRR3744767	flower	no	mature	0.015639
SRR3744768	flower	no	mature	0.0627218
SRR6308190	stigmas	no	open flowers	0
SRR6308181	styles	no	open flowers	0
SRR6308188	filaments	no	open flowers	0
SRR6308187	anthers	no	buds 1-3 days prior to flower opening	0
SRR6308192	pollen	no	open flowers	0
SRR6308191	petals	no	open flowers	0
SRR6308194	sepals	no	open flowers	0
SRR6308193	receptacles	no	open flowers	0
SRR6308189	ovaries	no	open flowers	0
SRR3384922	fruit	no	1 week after full bloom	3.0565
SRR3384921	fruit	no	2 week after full bloom	3.56967
SRR3384920	fruit	no	3 week after full bloom	1.76323
SRR3384919	fruit	no	4 week after full bloom	0.779071
SRR3384923	fruit	no	5 week after full bloom	0.370445
SRR3384918	fruit	no	6 week after full bloom	0.674807
SRR3384917	fruit	no	8 week after full bloom	0
SRR3384916	fruit	no	10 week after full bloom	0.0351563
SRR3384915	fruit	no	12 week after full bloom	0
SRR3384914	fruit	no	14 week after full bloom	0
SRR3384913	fruit	no	16 week after full bloom	0
SRR3384912	fruit	no	18 week after full bloom	0
SRR3384911	fruit	no	19 week after full bloom	0
SRR3384910	fruit	no	20 week after full bloom	0
SRR768128	whole fruit	no	25 days post anthesis	1.93824
SRR768129	whole fruit	no	35 days post anthesis	1.8092
SRR768130	whole fruit	no	60 days post anthesis	0.0892147
SRR768131	whole fruit	no	87 days post anthesis	0
SRR7343308	immature fruit flesh	no	immature	0.949994
SRR7343309	immature fruit flesh	no	immature	0.473851
SRR6320494	ripe fruit flesh	no	mature	0
SRR5405143	ripe fruit peel	no	mature	0
SRR6320572	ripe fruit peel	no	mature	0
SRR7403504	fruit	uninfected	mature	0
SRR7403506	fruit	uninfected	mature	0
SRR7403507	fruit	uninfected	mature	0
SRR7403500	fruit	infected with penicillium expansum	mature	0
SRR7403501	fruit	infected with penicillium expansum	mature	0
SRR7403508	fruit	infected with penicillium expansum	mature	0
SRR7403502	fruit	infected with penicillium expansum	mature	0
SRR7403503	fruit	infected with penicillium expansum	mature	0.0533557
SRR7403505	fruit	infected with penicillium expansum	mature	0
SRR1613973	Central seeds	no	20DAPF	0.0841611
SRR1613974	Central seeds	no	20DAPF	0.0908611
SRR1613975	Central seeds	no	20DAPF	0.100929
SRR1613976	Lateral seeds	no	20DAPF	0.230023
SRR1613977	Lateral seeds	no	20DAPF	0.143722
SRR1613978	Lateral seeds	no	20DAPF	0.12573
SRR3744786	stem	no	mature	0.184047
SRR3744787	stem	no	mature	0.273053
SRR3744772	stem	no	mature	0.217873
SRX765691	seedling shoot apex	no	4-6 week old seedling	6.95414
SRX765683	tree shoot apex	no	Adult (tree), new shoot has 10-12 visible leaves	7.40774
SRR1089478	leaf	Virus-free	plantlets	2.7105
SRR1089477	leaf	ASGV-infected	plantlets	1.92229
SRR767660	leaf	uninfected	fully developed	0
SRR767669	leaf	2 days post infection by Venturia inaequalis	fully developed	0
SRR767670	leaf	4 days post infection by Venturia inaequalis	fully developed	0.512517
SRR767671	leaf	6 days post infection by Venturia inaequalis	fully developed	0
SRR767672	leaf	8 days post infection by Venturia inaequalis	fully developed	0
SRR767673	leaf	10 days post infection by Venturia inaequalis	fully developed	0.716526
SRR767674	leaf	12 days post infection by Venturia inaequalis	fully developed	0
SRR768127	leaf	14 days post infection by Venturia inaequalis	fully developed	0
SRR6308182	young leaf	no	immature leaves	8.79027
SRR3744769	leaf	no	mature	0.112955
SRR3744770	leaf	no	mature	0.0593364
SRR3744771	leaf	no	mature	0.0194649
SRR5405145	leaf	no	mature	0.275455
SRR6320561	leaf	no	mature	0.203263