Gene detail

Detail information of MD10G1144200 Annotation

Gene ID	Annotation
MD10G1144200	FAR1-related sequence 9

Network

Network Category	Global Network	Conditional network (different tissues and developmental stages)
Coexpression Positive	Top300 PCC genelist	Top300 PCC genelist
Coexpression Negative	Top300 PCC genelist	Top300 PCC genelist

Functional module

Method	Module ID	Function Annotation
Co-expression network	CFinderM0886	type I protein arginine methyltransferase [EC:2.1.1.319] mRNA cleavage and polyadenylation specificity factor complex lysyl-tRNA aminoacylation protein methylation cullin deneddylation DNA demethylation mRNA cleavage mRNA polyadenylation photomorphogenesis gene silencing protein methyltransferase activity lysine-tRNA ligase activity

Gene structure and chromatin state

more details in UCSC

details of chromatin state

Location

Gene	Type	Chr	Start	End	Strand
MD10G1144200	mRNA	Chr10	23103100	23106355	+

Sequences

CDS:

MD10G1144200

TGGAGCTTTAAGCAGCGCCTAGGCGGGCCTCTCTATCACTCTCAACTCTCAACGCTTAAGAAACACAATCGCCAGAGGACGACGGCGATCGGGACTTGCCTTTGATTTTGACGAAGACCCACTATTCCGTGCAGCAGAGCTCGATTGCCGTTTTGGTTAATTTGAGAAGCTACATGAGTGGCATCAGACAGAGGACCCTTGGGGGTGGGGGTCAGCATGTTCTGGACTATCTAAAAAGAATGCAGGCAGACAATCCTGCTTTCTTTTATGCCGTTCAGAGTGATAGTGATCACTCTAATGGTAATATATTTTGGGTGGACGCAACAGCCAGGATGAACTATACATATTTTGGAGATGCTGTTATATTTGACACTTCGTATAGGATAAACCGCTACAGGGTACCGTTTGCCTCATTCTCCGGATTTAATCATCATGGCCAGCCGGTGTTGTTTGGCTGTGCGTTAGTTATTAATGAGTCTGAGTCCTCCTTCGTATGGCTATTTCAAACTTGGCTTCATGCAATGGCTGGACGCTTCCCTGTCTCTATCACTACTGATCCAGATAGGCACATGCAAGTTGCAGTTGCGCAAATTCTTCCTGAAACCCGCCATCGCTTCTGTAAGTGGGCCATATTTAAACAAACACAAGAGAAGTTGGATCAGCTGTATCATTCTCATCCTACTTTCGAAACCGAGTTTAAGAAGTGTGTCAATGAGAGTGAGACAATTGATGAGTTTGAGTCACGTTGGCAGTCATTGCTCGGAAGATACTACATCATGGATAATGAGTGGCTTCAATCCATGTACAATGCTAGGCAACAGTGGGTCCCGGTTTACATGAAGGACACCTTTTTTGGAGAGTTTGCTGTAAGTGAGGGAAGTGAAAGGTTAGCCTTGTTTTTTGATGGGTATGTGAATGCATCCACTACCATGCAGGTTTTGATTAAGCAGTACGAGAAAGCTTTAGTTAGTTGGCATGAAATGGAATTAAAAGCAGATTATGACACTACTAATACTATGCCAGTTCTGAAGACACCGTCTCCTATGGAAAAACAAGCTGCAAACCTCTATACAAGGAGAATATTTAAGAAGTTCCAGGAGGAGTTGGTTGAGACCATGGCAAATCCTGCAACCAAAATTGATGACTCAGGAACTGTTGCCACCTATCGAGTGGCCAAATTTGGAGAAGACCACAAAGCTCATGCTGTTAGTTTCAATTCCTTTGAGATGAAAGCTAGTTGTAGTTGTCAAATGTTTGAATATTCAGGGATAATCTGTAGGCACATACTGGCAGTTTTTAGAGCAAAGAATGTTCTCACACTTCCTCCTCAATATGTATTGAAACGATGGACAAGAAATGCCAAGAGTGGAGCTGGCGGATCTATGCTGGATGAACGTGCTTCTGAATCGCCAAGCAATTCTCGAGAGTCTGTAACAGTTAGGTATAACAATCTACGTCAGGAAGCAATCAAATATGTAGAAGAGGGAGCAAGGTCTATCCACATATACAATGTAGCGATGAATGCTCTACAGGAAGCTGCTAAGAAAGTTGCTGCTATGAAGAATAAAGGTTCTGGAGCTACACAGGGTAGTTCCCTTGCCAATGGAGGTAGCCAAGAAATTCCTGCGACTGAAGCGAATGAAATGGCAGGGTATCAATCCACGGATGAGAAGGAAAAGAAAATCCGCGAATTGTCTGCTGAGTTGGAGGACACCAACAAACGCTGTGAAGTTTATCGTGCAAATCTGCTTGCTGTTCTACGAGATATGGAAGAGCAGAAGTCGAAGCTTTCGGTGAAGGTTCAAAGTGCAAGGCTAAGTCTGAAGGAGTGAATGCTATCTTAGCCACGGGTTAACGTCCTCTAATGTCAATACTAGGAAGCTGTAACGTTAGGTCTTCGCCGTCTTTAGCCATTTGTAACAGTTTATTACTTATTTGTGACAAATTCATGCTTTATTGTGATTTTGAATAATTAATAACCCGTTTCATAACC

Protein:

Gene family

Gene family	Subfamily
--	--

Orthologous genes

Species	Gene ID	Score of Inparanoid	Annotation
Arabidopsis thaliana	AT4G38170.1	1	FRS9\|FAR1-related sequence 9
Prunus persica	Prupe.8G182800.1.p	1	FAR1-related sequence 9
Rosa multiflora	Rmu_ssc0000211.1_g000016.1	1	-
Rubus occidentalis	Ro02_G15132	1	-
Fragaria vesca	mrna17118.1	1	FAR1-related sequence 9
Vitis vinifera	GSVIVT01023847001	1	FAR1-related sequence 9
Solanum lycopersicum	Solyc07g008700.2.1	1	FAR1-related sequence 9
Populus trichocarpa	Potri.004G209100.1	1	FAR1-related sequence 9
Nicotiana benthamiana	Niben101Scf10056g01006.1	1	Protein FAR1-RELATED SEQUENCE 9

Gene Ontology

GO term	Description	Category
GO:0008270	zinc ion binding	molecular_function

KEGG

KO	Description	Enzyme
--	--	--

Pfam domain

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF10551.5	MULE	47	133	4.40E-19
PF04434.13	SWIM	329	357	7.50E-12

Expression pattern

SRA Experiment	Tissue	Stress	Stage	FPKM
SRR768136	whole seedling	no	seedling	4.89402
SRR5252888	dormant buds	no	dormant buds(0 month)	11.1985
SRR5252889	dormant buds	no	dormant buds(0 month)	11.2432
SRR5252886	dormant buds	no	dormant buds(1 months)	10.5374
SRR5252887	dormant buds	no	dormant buds(1 months)	11.5352
SRR5252884	dormant buds	no	dormant buds(2 months)	11.1782
SRR5252882	dormant buds	no	dormant buds(3 months)	10.3142
SRR5252883	dormant buds	no	dormant buds(3 months)	11.0925
SRR5252880	dormant buds	no	dormant buds(4 months)	14.0531
SRR5252881	dormant buds	no	dormant buds(4 months)	11.1275
SRR5252878	bud break	no	bud break	10.1637
SRR5252879	bud break	no	bud break	10.6772
SRR3744766	flower	no	mature	3.36364
SRR3744767	flower	no	mature	3.67616
SRR3744768	flower	no	mature	3.65446
SRR6308190	stigmas	no	open flowers	5.28841
SRR6308181	styles	no	open flowers	4.48916
SRR6308188	filaments	no	open flowers	2.76796
SRR6308187	anthers	no	buds 1-3 days prior to flower opening	1.81016
SRR6308192	pollen	no	open flowers	1.08257
SRR6308191	petals	no	open flowers	1.42035
SRR6308194	sepals	no	open flowers	3.51762
SRR6308193	receptacles	no	open flowers	7.13565
SRR6308189	ovaries	no	open flowers	5.50281
SRR3384922	fruit	no	1 week after full bloom	4.11414
SRR3384921	fruit	no	2 week after full bloom	4.58962
SRR3384920	fruit	no	3 week after full bloom	4.68144
SRR3384919	fruit	no	4 week after full bloom	4.32496
SRR3384923	fruit	no	5 week after full bloom	5.16761
SRR3384918	fruit	no	6 week after full bloom	3.56115
SRR3384917	fruit	no	8 week after full bloom	3.89841
SRR3384916	fruit	no	10 week after full bloom	3.96341
SRR3384915	fruit	no	12 week after full bloom	3.90788
SRR3384914	fruit	no	14 week after full bloom	3.79009
SRR3384913	fruit	no	16 week after full bloom	3.96808
SRR3384912	fruit	no	18 week after full bloom	4.32896
SRR3384911	fruit	no	19 week after full bloom	3.52695
SRR3384910	fruit	no	20 week after full bloom	3.53053
SRR768128	whole fruit	no	25 days post anthesis	6.01828
SRR768129	whole fruit	no	35 days post anthesis	4.83176
SRR768130	whole fruit	no	60 days post anthesis	3.91078
SRR768131	whole fruit	no	87 days post anthesis	4.83604
SRR7343308	immature fruit flesh	no	immature	7.68579
SRR7343309	immature fruit flesh	no	immature	8.65692
SRR6320494	ripe fruit flesh	no	mature	4.99139
SRR5405143	ripe fruit peel	no	mature	5.25283
SRR6320572	ripe fruit peel	no	mature	2.89279
SRR7403504	fruit	uninfected	mature	3.73191
SRR7403506	fruit	uninfected	mature	3.96685
SRR7403507	fruit	uninfected	mature	3.51053
SRR7403500	fruit	infected with penicillium expansum	mature	1.0851
SRR7403501	fruit	infected with penicillium expansum	mature	0.357835
SRR7403508	fruit	infected with penicillium expansum	mature	1.2898
SRR7403502	fruit	infected with penicillium expansum	mature	1.19665
SRR7403503	fruit	infected with penicillium expansum	mature	2.39467
SRR7403505	fruit	infected with penicillium expansum	mature	1.60187
SRR1613973	Central seeds	no	20DAPF	8.74541
SRR1613974	Central seeds	no	20DAPF	8.66333
SRR1613975	Central seeds	no	20DAPF	8.06358
SRR1613976	Lateral seeds	no	20DAPF	7.70013
SRR1613977	Lateral seeds	no	20DAPF	9.27071
SRR1613978	Lateral seeds	no	20DAPF	8.9005
SRR3744786	stem	no	mature	5.36386
SRR3744787	stem	no	mature	5.81885
SRR3744772	stem	no	mature	5.40537
SRX765691	seedling shoot apex	no	4-6 week old seedling	6.10333
SRX765683	tree shoot apex	no	Adult (tree), new shoot has 10-12 visible leaves	5.30702
SRR1089478	leaf	Virus-free	plantlets	2.34375
SRR1089477	leaf	ASGV-infected	plantlets	2.82107
SRR767660	leaf	uninfected	fully developed	1.96791
SRR767669	leaf	2 days post infection by Venturia inaequalis	fully developed	5.95443
SRR767670	leaf	4 days post infection by Venturia inaequalis	fully developed	4.21801
SRR767671	leaf	6 days post infection by Venturia inaequalis	fully developed	3.17748
SRR767672	leaf	8 days post infection by Venturia inaequalis	fully developed	0
SRR767673	leaf	10 days post infection by Venturia inaequalis	fully developed	2.13601
SRR767674	leaf	12 days post infection by Venturia inaequalis	fully developed	3.72717
SRR768127	leaf	14 days post infection by Venturia inaequalis	fully developed	3.44983
SRR6308182	young leaf	no	immature leaves	5.07149
SRR3744769	leaf	no	mature	5.07299
SRR3744770	leaf	no	mature	4.73194
SRR3744771	leaf	no	mature	5.38947
SRR5405145	leaf	no	mature	3.73758
SRR6320561	leaf	no	mature	1.80268