Gene detail

Detail information of MD13G1244100 Annotation

Gene ID	Annotation
MD13G1244100	SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein

Network

Network Category	Global Network	Conditional network (different tissues and developmental stages)
Coexpression Positive	Top300 PCC genelist	Top300 PCC genelist
Coexpression Negative	Top300 PCC genelist	Top300 PCC genelist

Functional module

Method	Module ID	Function Annotation
Co-expression network	CFinderM0426	spliceosomal complex endosomal transport mitotic nuclear division cell morphogenesis vacuole organization leaf senescence cell growth splicing factor 3A subunit 1 protein targeting to vacuole mitochondrial proton-transporting ATP synthase complex Golgi vesicle transport Golgi organization catalytic activity

Gene structure and chromatin state

more details in UCSC

details of chromatin state

Location

Gene	Type	Chr	Start	End	Strand
MD13G1244100	mRNA	Chr13	25470748	25474979	+

Sequences

CDS:

MD13G1244100

GTTCGCATAAACCCGCTCATTCATCCTCTCTCACACACACAGAGTAGGGCTTCGAAACCCTAGAAGAGGTGGAATCATCTGGTTAGAACCCTAAGGTTGTGGTTAGGACAAGGTTGTTTTTATGCCTGTTAGGAAAATGATAGGGTCCATTTTGCCCTTACCGGCTCCTCCTTCTGATGGAGACCTTGGGCCTCTTCCGGAATCCCAAGTGACTGAACTTAGTCAGGATGAGAACCAATTGAACGAGGAGCTGAGCAAAGCCAACTCTACTTCAGTTGCAACGCATACCAGGGCTATTGGTATCATACATCCTCCTCCAGACATTAGAAACATTGTTGACAAAACTGCCCAATTTGTGGCAAAGAATGGACCAGAGTTTGAGAAAAGGATTATGGCTAATAATACCGGAAATGCAAAGTTCAGTTTCTTGATTTCGACAGATCCCTACCATGCATATTATCAGCATCGGTTGTCTGAATTCCGTGCCCTGAATCAGTCTTCTGGACAGCAACCATCTACACAGCCTGCAGATTCTGCTTCACCTGAGTCTGCCCCACCAGCTCCAGCTGCAGATGGTGAAGCAGGAGCCCCAAAGCCTGATCCCTCTGCCCAGTTTAGACCTGTTCGCAAAGTGCTCGAACCACCACAAGCTGAGGAGTATACTGTTCGTCTTCCTGAAGGTATTACCGGGGAAGAGTTGGATATTATTAAGCTCACAGCGCAGTTTGCAGCTCGAAATGGGAAAACATTTTTGCAAGGATTGACAAGCAGGGAAATGAATAACCACCAGTTCCATTTTCTGAAGCCTATGCATAGCATGTTCACATTTTTCACTTCTCTGGCTGATGCATATTCTAAGGTGTTGATGCCTCCGGAGAATTTGCAAGATAAGCTTAAGAAAAGTGTTGCAGACATGACAACTGTGCTCGAAAGGTGTGTCCATCGACTGGAGTGGGAGCGTTCACAAGAGCAGGCAAGACAGAAGGCTGAAGATGAGATTGAGCAGGAAAGAATACAAATGGCTATGATTGATTGGCATGACTTTGTTGTGGTTGAAACAATAGACTTTGCAGATGATGAGGATGAGGATTTACCTCCTCCGATGACCCTTGAGGAGGTTATTAGGAGAAGCAAGGTCGCTGATATGGAAGAGGACATTGTTGAGCCTGGTAAGGAGGTGGAAATGGAAATGGATGAAGAAGAGATGCAGCTTGTTGAAGAGGGCTTGAGGACAGCCAGACTTGAAGAGAATGATGATGAAAAGAGGAACGAGAATATGGTGACAGAGGATCCAGAACCACCAATGAGAATTGTGAAGAACTGGAAGAGACCTGAGGACAGGATCCCTGCCGAAAGAGACCCAACAAAGTATGTCATTTCCCCAATCACTGGAGAGCTCATACCTATCAATGAGATGTCTGAACACATGAGGATTTCTCTCATTGATCCAAAATACAAAGAGCAAAAGGAAAGGATGTTTGCTAAGATTCGGGAGACTACTCTTGCTCAAGATGATGAAATCTCAAGAAACATTGTGGGCCTTGCACGAACCCGTCCTGATATTTTTGGTACCACAGAGGAAGAAGTGTCTAATGCTGTCAAGGCTGAGATTGAGAAAAAGAAAGATGAGCAACCAAAGCAGGTCATCTGGGATGGTCACACTGGAAGTATTGGCCGCACAGCAAATCAAGCAATGTCGCAGAATATCAATGGAGAGGACCAAAATGATGGTCTTAACAATGATGCTAGGAACCTTCCTGGTCCTGCAGCTCCTCCTCCAAAACCTGGTGTGCCTTCAATTCGTCCTCTTCCTCCACCACCTGGTCTTGCCTTGAATCTACCTCGTCCTCCAAACACAGTCCAGTATTCTGCTCCAACTAGCGGCGGTCTCCCTGCACCTCCACCAAGGCCCCCGGTTGTCCAATATCAATCAATTCGACCACCTGGACCCCCAATGCCCATGAGTTCTGGACAGCAGTCCCTTATGCTCAACCGACCACCTCCTATGCACCCATCCATGTCTATGAATGCACCTGCTATTTCTGTACCACCTCCACCTGGTTCTCAGTTTACACCAATGCAAGTTCCCCGACCTTATATGCCTCTTCCTGTTCCTCCACCTACAATGCAAATGATGCCACCCCCACCTTTGCCTCAAGGAATGCCACCACCACCACCTGAAGAAGCTCCTCCACCGCTTCCAGAAGAACCTGAGCCAAAGCGGCAGAAGCTTGATGATTCTATGCTTATTCCAGAAGATCAGTTTCTGGCACAGCATCCGGGACCTGTTCGCATCACAGTATCTGTGCCCAATGTTGATGAAGGTAATCTAAAGGGACAACTTTTGGAGATCTTGGTGCAGTCTTTATCAGAAACTGTTGGTAGTTTGAAAGAGAAAATTTCTGGGGAGATCCAGCTTCCAGCAAACAAACAGAAGTTGAGTGGAAAACCTGGTTTTCTCAAGGACAACATGTCACTTGCATATTACAATGTTGGAGCAGCTGAAACACTTACTCTTTCATTAAGGGAGCGTGGTGGAAGAAAGAGATGAAAATATTATCTGACCGAGCGATTAAGGCAATAGCAAAGCAGTGGCTGGTAAAGTTGGTAATTTCTGATGATGGTTGTTAACTAGAGGATAGAAGCTTTAGAGGTACTTGTGGCCATAACTGGGTCCGTGCAACCATTCTTTAAGCATCTCAGCAAGGATTATTAGAGCAGTGGTGAAATACGGAATGATATTAGTATTGGATTTGGTGTTACTTGATGCTTGT

Protein:

Gene family

Gene family	Subfamily
--	--

Orthologous genes

Species	Gene ID	Score of Inparanoid	Annotation
Arabidopsis thaliana	AT1G14650.2	1	SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein
Arabidopsis thaliana	AT1G14650.1	1	SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein
Prunus persica	Prupe.1G077400.4.p	1	SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein
Prunus persica	Prupe.1G077400.11.p	1	SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein
Prunus persica	Prupe.1G077400.5.p	1	SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein
Prunus persica	Prupe.1G077400.7.p	1	SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein
Prunus persica	Prupe.1G077400.8.p	1	SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein
Prunus persica	Prupe.1G077400.9.p	1	SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein
Prunus persica	Prupe.1G077400.6.p	1	SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein
Prunus persica	Prupe.1G077400.10.p	1	SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein
Prunus persica	Prupe.1G077400.3.p	1	SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein
Prunus persica	Prupe.1G077400.2.p	1	SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein
Prunus persica	Prupe.1G077400.1.p	1	SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein
Pyrus communis	PCP023183.1	1	-
Rosa multiflora	Rmu_co8505131.1_g000001.1	1	-
Rosa multiflora	Rmu_sc0014676.1_g000002.1	1	-
Rubus occidentalis	Ro06_G17372	1	-
Rubus occidentalis	Ro04_G24053	0.66	-
Fragaria vesca	mrna17227.1	1	SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein
Vitis vinifera	GSVIVT01012058001	1	SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein
Solanum lycopersicum	Solyc02g081960.2.1	0.707	SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein
Solanum lycopersicum	Solyc04g005690.2.1	1	SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein
Populus trichocarpa	Potri.007G070700.9	1	SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein
Populus trichocarpa	Potri.005G094600.9	0.643	SWAP (Suppressor-of-White-APricot)/surp domain-containing protein / ubiquitin family protein
Nicotiana benthamiana	Niben101Scf00907g00001.1	1	Splicing factor 3A subunit 1
Oryza sativa	LOC_Os02g14780.2	1	"splicing factor 3 subunit 1, putative, expressed"
Zea mays	GRMZM2G028156_P01	1	-
Zea mays	GRMZM2G431306_P01	0.886	-

Gene Ontology

GO term	Description	Category
GO:0003723	RNA binding	molecular_function
GO:0005515	protein binding	molecular_function
GO:0006396	RNA processing	biological_process

KEGG

KO	Description	Enzyme
K12825	splicing factor 3A subunit 1	-

Pfam domain

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00240.19	ubiquitin	748	804	1.40E-07

Expression pattern

SRA Experiment	Tissue	Stress	Stage	FPKM
SRR768136	whole seedling	no	seedling	10.898
SRR5252888	dormant buds	no	dormant buds(0 month)	38.8224
SRR5252889	dormant buds	no	dormant buds(0 month)	35.1576
SRR5252886	dormant buds	no	dormant buds(1 months)	38.4424
SRR5252887	dormant buds	no	dormant buds(1 months)	48.9114
SRR5252884	dormant buds	no	dormant buds(2 months)	47.4759
SRR5252882	dormant buds	no	dormant buds(3 months)	39.8875
SRR5252883	dormant buds	no	dormant buds(3 months)	46.0789
SRR5252880	dormant buds	no	dormant buds(4 months)	46.028
SRR5252881	dormant buds	no	dormant buds(4 months)	49.3632
SRR5252878	bud break	no	bud break	40.951
SRR5252879	bud break	no	bud break	35.0023
SRR3744766	flower	no	mature	22.1711
SRR3744767	flower	no	mature	21.7341
SRR3744768	flower	no	mature	21.4609
SRR6308190	stigmas	no	open flowers	14.6635
SRR6308181	styles	no	open flowers	19.1126
SRR6308188	filaments	no	open flowers	18.0202
SRR6308187	anthers	no	buds 1-3 days prior to flower opening	11.045
SRR6308192	pollen	no	open flowers	10.9443
SRR6308191	petals	no	open flowers	18.8408
SRR6308194	sepals	no	open flowers	20.8729
SRR6308193	receptacles	no	open flowers	15.7966
SRR6308189	ovaries	no	open flowers	18.0717
SRR3384922	fruit	no	1 week after full bloom	12.5435
SRR3384921	fruit	no	2 week after full bloom	12.0619
SRR3384920	fruit	no	3 week after full bloom	10.148
SRR3384919	fruit	no	4 week after full bloom	9.88902
SRR3384923	fruit	no	5 week after full bloom	8.86698
SRR3384918	fruit	no	6 week after full bloom	9.84358
SRR3384917	fruit	no	8 week after full bloom	12.0524
SRR3384916	fruit	no	10 week after full bloom	12.138
SRR3384915	fruit	no	12 week after full bloom	12.2194
SRR3384914	fruit	no	14 week after full bloom	12.8753
SRR3384913	fruit	no	16 week after full bloom	12.6834
SRR3384912	fruit	no	18 week after full bloom	12.1614
SRR3384911	fruit	no	19 week after full bloom	11.1989
SRR3384910	fruit	no	20 week after full bloom	13.432
SRR768128	whole fruit	no	25 days post anthesis	18.7855
SRR768129	whole fruit	no	35 days post anthesis	24.5697
SRR768130	whole fruit	no	60 days post anthesis	20.0786
SRR768131	whole fruit	no	87 days post anthesis	26.4239
SRR7343308	immature fruit flesh	no	immature	12.5709
SRR7343309	immature fruit flesh	no	immature	11.6787
SRR6320494	ripe fruit flesh	no	mature	18.2073
SRR5405143	ripe fruit peel	no	mature	30.4883
SRR6320572	ripe fruit peel	no	mature	24.9682
SRR7403504	fruit	uninfected	mature	22.1883
SRR7403506	fruit	uninfected	mature	24.2268
SRR7403507	fruit	uninfected	mature	25.49
SRR7403500	fruit	infected with penicillium expansum	mature	19.954
SRR7403501	fruit	infected with penicillium expansum	mature	17.5428
SRR7403508	fruit	infected with penicillium expansum	mature	19.2836
SRR7403502	fruit	infected with penicillium expansum	mature	19.5551
SRR7403503	fruit	infected with penicillium expansum	mature	21.2993
SRR7403505	fruit	infected with penicillium expansum	mature	20.3291
SRR1613973	Central seeds	no	20DAPF	26.7617
SRR1613974	Central seeds	no	20DAPF	28.185
SRR1613975	Central seeds	no	20DAPF	30.0861
SRR1613976	Lateral seeds	no	20DAPF	25.7081
SRR1613977	Lateral seeds	no	20DAPF	25.7541
SRR1613978	Lateral seeds	no	20DAPF	27.0435
SRR3744786	stem	no	mature	26.2778
SRR3744787	stem	no	mature	24.5123
SRR3744772	stem	no	mature	26.9786
SRX765691	seedling shoot apex	no	4-6 week old seedling	27.5756
SRX765683	tree shoot apex	no	Adult (tree), new shoot has 10-12 visible leaves	21.5632
SRR1089478	leaf	Virus-free	plantlets	53.0534
SRR1089477	leaf	ASGV-infected	plantlets	51.4957
SRR767660	leaf	uninfected	fully developed	22.6096
SRR767669	leaf	2 days post infection by Venturia inaequalis	fully developed	45.3896
SRR767670	leaf	4 days post infection by Venturia inaequalis	fully developed	23.3418
SRR767671	leaf	6 days post infection by Venturia inaequalis	fully developed	5.89953
SRR767672	leaf	8 days post infection by Venturia inaequalis	fully developed	9.32227
SRR767673	leaf	10 days post infection by Venturia inaequalis	fully developed	17.4989
SRR767674	leaf	12 days post infection by Venturia inaequalis	fully developed	23.9242
SRR768127	leaf	14 days post infection by Venturia inaequalis	fully developed	22.0543
SRR6308182	young leaf	no	immature leaves	19.4943
SRR3744769	leaf	no	mature	24.0013
SRR3744770	leaf	no	mature	24.3474
SRR3744771	leaf	no	mature	24.6339
SRR5405145	leaf	no	mature	21.0919
SRR6320561	leaf	no	mature	11.1633