Gene detail

Detail information of MD14G1210700 Annotation

Gene ID	Annotation
MD14G1210700	Cytochrome P450 superfamily protein

Network

Network Category	Global Network	Conditional network (different tissues and developmental stages)
Coexpression Positive	Top300 PCC genelist	Top300 PCC genelist
Coexpression Negative	Top300 PCC genelist	Top300 PCC genelist

Functional module

Method	Module ID	Function Annotation
Co-expression network	CFinderM0167	response to UV-B response to sucrose anthocyanin-containing compound biosynthetic process chalcone biosynthetic process response to gravity chalcone synthase [EC:2.3.1.74] naringenin-chalcone synthase activity regulation of anthocyanin biosynthetic process plant-type vacuole membrane negative regulation of flavonoid biosynthetic process auxin polar transport anthocyanidin reductase activity response to oxidative stress anthocyanidin reductase [EC:1.3.1.77] response to karrikin response to auxin chalcone isomerase activity response to jasmonic acid chalcone isomerase [EC:5.5.1.6] response to wounding coenzyme binding CYP75B32v3 salicylic acid catabolic process pre-autophagosomal structure endoplasmic reticulum naringenin 3-dioxygenase activity autophagosome assembly GT75 carbohydrate kinase activity dihydrokaempferol 4-reductase activity intramolecular transferase activity phenylalanine ammonia-lyase activity UDP-arabinopyranose mutase activity response to growth hormone flavonoid 3'-monooxygenase [EC:1.14.13.21] beclin naringenin 3-dioxygenase [EC:1.14.11.9] phenylalanine ammonia-lyase [EC:4.3.1.24] glycogenin glucosyltransferase activity

Gene structure and chromatin state

more details in UCSC

details of chromatin state

Location

Gene	Type	Chr	Start	End	Strand
MD14G1210700	mRNA	Chr14	29630776	29634806	+

Sequences

CDS:

MD14G1210700

CAAAAATTAAAAACTAGATAAACTATTAGTGAAAATTCAACCTAACCCACCCAACAAATTGAACACGATCCCAACCTACCCAGCGCACCGGAACCCTCCCTCTGCCCACCCTCCTATATATTGTATCCAACACCACTATACACTGAACTCCACACACAATCTAAACAGCATGTTTGTTCTCATAGTCTTCACCGTCGTCTTTGCCTTCTTCTTATACCGGATATTTGCCCCTGGCGGGAGCCGTCACTCTCTGCCTCTTCCGCCGGGGCCGAAACCTTGGCCTGTAGTAGGGAACCTGCCCCACTTAGGCCCCGTTCCCCACCACTCTCTGGCGGCTTTGGCCCGTCAGTATGGACCCCTCATGCACCTCCGCTTGGGGTTTGTTGACGTGGTTGTTGCCGCCTCCGCCTCCGTGGCGTCACAGTTTCTGAAGACCCATGACGCTAATTTCTCGAGCCGGCCACCCAACTCCGGCGCCAAGCATCTCGCTTACAACTACCAAGACTTGGTGTTCGCGCCGTACGGTCCACGGTGGCGATTGTTGCGGAAGATCAGCTCCGTCCATTTGTTCTCCGGCAAGGCTCTGGATGATCTTAAACACGTTCGCCAGGAGGAGGTAGGTGTGCTTGCACATGGATTAGCAAGTGCAGGGTCAAAGCCAGTGAACTTGGCGCAACTACTGAACGTGTGCACGGTGAACGCCCTAGGGCGGGTGATGGTAGGACGGAGGCTCTTCGGCAACGGCATGGGCGGCGAAGACCCAAAGGCGGATGAGTTCAAGTCCATGGTGGTGGAGATGATGGTGTTGGCCGGAGTATTCAACATCGGCGACTTCATCCCCTCCCTAGAGTGGCTGGACTTGCAGGGGGTGGCGGGAAAGATGAAGAAGCTACACAAGAGGTTCGATGCCTTCTTGACCGCCATTGTTGAAGAGCACAAGAGGAGCCGCGGAGGGAAGCACGTCGACATGCTGACGACGTTGCTGTCGCTCAAGGAGGATGCCGACGGTGAGGGCGCCAAGCTCACAGACACTGAGATTAAAGCTTTGCTTTTGAACATGTTTACAGCTGGCACTGACACGTCATCAAGCACAGTGGAATGGGCCATAGCCGAACTCCTTCGCCACCCCAAAATTCTAGCCCAACTCCAACAAGAGCTGGATCAAGTCGTGGGTCGGGACCGGCTCGTAACCGAATCGGACCTGCCCAACCTGACCTACCTCCAAGCCGTGATCAAGGAAACCTTCCGGCTCCACCCATCCACCCCGCTCTCTCTTCCCCGAATGGCGACCGAGAGTTGCGAAATCAACGGATTTCACATTCCTAAGGGTGCCACTCTCTTGGTCAACGTATGGGCCGTATCTCGCGATCCGGATCAATGGTCCGAACCGCTCGAGTTTAGGCCCGAGCGGTTCATGTCGGGAGGTGAGAAGCCCAATGTCGACATTAGGGGGAATGACTTCGAGGTCATACCGTTCGGGGCCGGGCGTAGAATATGTGCCGGGATGAGCCTTGGGTTGCGGATGGTGTCTCTGATGACTGCAACCCTGGTCCATGGTTTTGATTGGACCTTGGCCGATGGGCTGACCCCTGAGAAGTTGAACATGGACGAGGCCTATGGGCTCACCCTACAAAGAGCCGCACCGTTAATGGTGCACCCGCGTAACAGGCTAGCCCCTCATGCATACAATGCATCATCATCTTGAATTCTTGAGAGTGCTATGTGGTGGTGATGATTTTATGGAAAATTTGTTGTCTTTGTTACTAGTATTCACGTTTGGTTTGGATGTTAAGTTGAATGAAATGGTGGTTTTGTTTCTCCAAGAATTCTACAAGAAAGTGTGTCTAGTATTTTCTTTGTGTTGTTTGCAAGTAGAAGTGCTTCTTTGTTTGAGACTCGATGATCTGCTTGTCGTGTCCGTTATTTTACTTAAAATATCTTAAATATATGTAAGTATTTTAACTAAATCCCACACAAGATACCAAGAGCAAACATTGATGTAGTCAAGTCAGCTGGGAAAACGTATTATCTTTTTATATCCAAATTTGAAT

Protein:

Gene family

Gene family	Subfamily
Cytochrome P450 Family	CYP75B

Orthologous genes

Species	Gene ID	Score of Inparanoid	Annotation
Arabidopsis thaliana	AT5G07990.1	1	CYP75B1;D501;TT7\|CYTOCHROME P450 75B1;;TRANSPARENT TESTA 7
Prunus persica	Prupe.5G203600.1.p	1	Cytochrome P450 superfamily protein
Pyrus x bretschneideri	Pbr007219.1	1	-
Rosa multiflora	Rmu_sc0000014.1_g000019.1	1	-
Rubus occidentalis	Ro05_G03327	1	-
Fragaria vesca	mrna25801.1	1	Cytochrome P450 superfamily protein
Vitis vinifera	GSVIVT01007878001	1	Cytochrome P450 superfamily protein
Solanum lycopersicum	Solyc03g115220.2.1	1	Cytochrome P450 superfamily protein
Solanum lycopersicum	Solyc03g122360.2.1	1	Cytochrome P450 superfamily protein
Solanum lycopersicum	Solyc01g010260.2.1	1	"cytochrome P450, family 93, subfamily D, polypeptide 1"
Populus trichocarpa	Potri.013G073300.1	1	Cytochrome P450 superfamily protein
Nicotiana benthamiana	Niben101Scf00974g01018.1	1	Cytochrome P450 superfamily protein LENGTH=513
Oryza sativa	LOC_Os10g17260.1	1	"cytochrome P450, putative, expressed"
Oryza sativa	LOC_Os03g25150.1	1	"transposon protein, putative, unclassified, expressed"
Zea mays	GRMZM2G025832_P01	1	-
Zea mays	GRMZM2G313750_P01	0.878	Putative cytochrome P450 superfamily protein

Gene Ontology

GO term	Description	Category
GO:0020037	heme binding	molecular_function
GO:0055114	oxidation-reduction process	biological_process
GO:0005506	iron ion binding	molecular_function
GO:0009055	electron carrier activity	molecular_function

KEGG

KO	Description	Enzyme
K05280	flavonoid 3'-monooxygenase	EC:1.14.13.21

Pfam domain

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00067.18	p450	31	481	6.10E-108

Expression pattern

SRA Experiment	Tissue	Stress	Stage	FPKM
SRR768136	whole seedling	no	seedling	18.3796
SRR5252888	dormant buds	no	dormant buds(0 month)	18.1953
SRR5252889	dormant buds	no	dormant buds(0 month)	20.1012
SRR5252886	dormant buds	no	dormant buds(1 months)	8.46987
SRR5252887	dormant buds	no	dormant buds(1 months)	7.70034
SRR5252884	dormant buds	no	dormant buds(2 months)	1.47223
SRR5252882	dormant buds	no	dormant buds(3 months)	2.17142
SRR5252883	dormant buds	no	dormant buds(3 months)	1.79826
SRR5252880	dormant buds	no	dormant buds(4 months)	5.37439
SRR5252881	dormant buds	no	dormant buds(4 months)	4.23348
SRR5252878	bud break	no	bud break	12.4329
SRR5252879	bud break	no	bud break	14.6005
SRR3744766	flower	no	mature	0.253223
SRR3744767	flower	no	mature	0.173938
SRR3744768	flower	no	mature	0.221983
SRR6308190	stigmas	no	open flowers	4.84675
SRR6308181	styles	no	open flowers	5.60096
SRR6308188	filaments	no	open flowers	1.07264
SRR6308187	anthers	no	buds 1-3 days prior to flower opening	0
SRR6308192	pollen	no	open flowers	0.524375
SRR6308191	petals	no	open flowers	2.98168
SRR6308194	sepals	no	open flowers	30.9698
SRR6308193	receptacles	no	open flowers	3.42728
SRR6308189	ovaries	no	open flowers	9.55875
SRR3384922	fruit	no	1 week after full bloom	102.857
SRR3384921	fruit	no	2 week after full bloom	73.2271
SRR3384920	fruit	no	3 week after full bloom	103.304
SRR3384919	fruit	no	4 week after full bloom	113.301
SRR3384923	fruit	no	5 week after full bloom	109.927
SRR3384918	fruit	no	6 week after full bloom	82.3513
SRR3384917	fruit	no	8 week after full bloom	23.1989
SRR3384916	fruit	no	10 week after full bloom	7.10784
SRR3384915	fruit	no	12 week after full bloom	3.49012
SRR3384914	fruit	no	14 week after full bloom	4.68994
SRR3384913	fruit	no	16 week after full bloom	5.28379
SRR3384912	fruit	no	18 week after full bloom	4.05701
SRR3384911	fruit	no	19 week after full bloom	15.7808
SRR3384910	fruit	no	20 week after full bloom	1.28637
SRR768128	whole fruit	no	25 days post anthesis	51.1861
SRR768129	whole fruit	no	35 days post anthesis	114.195
SRR768130	whole fruit	no	60 days post anthesis	25.7923
SRR768131	whole fruit	no	87 days post anthesis	5.70205
SRR7343308	immature fruit flesh	no	immature	43.456
SRR7343309	immature fruit flesh	no	immature	54.1296
SRR6320494	ripe fruit flesh	no	mature	0
SRR5405143	ripe fruit peel	no	mature	2.67682
SRR6320572	ripe fruit peel	no	mature	4.00418
SRR7403504	fruit	uninfected	mature	0
SRR7403506	fruit	uninfected	mature	0.0238626
SRR7403507	fruit	uninfected	mature	0.0283327
SRR7403500	fruit	infected with penicillium expansum	mature	0.467071
SRR7403501	fruit	infected with penicillium expansum	mature	0.259921
SRR7403508	fruit	infected with penicillium expansum	mature	0.124917
SRR7403502	fruit	infected with penicillium expansum	mature	0.0965787
SRR7403503	fruit	infected with penicillium expansum	mature	0.323612
SRR7403505	fruit	infected with penicillium expansum	mature	0.0969627
SRR1613973	Central seeds	no	20DAPF	10.7799
SRR1613974	Central seeds	no	20DAPF	10.2115
SRR1613975	Central seeds	no	20DAPF	11.9139
SRR1613976	Lateral seeds	no	20DAPF	11.9655
SRR1613977	Lateral seeds	no	20DAPF	11.733
SRR1613978	Lateral seeds	no	20DAPF	9.04464
SRR3744786	stem	no	mature	0.837378
SRR3744787	stem	no	mature	1.23314
SRR3744772	stem	no	mature	0.991285
SRX765691	seedling shoot apex	no	4-6 week old seedling	62.2882
SRX765683	tree shoot apex	no	Adult (tree), new shoot has 10-12 visible leaves	63.1833
SRR1089478	leaf	Virus-free	plantlets	24.1106
SRR1089477	leaf	ASGV-infected	plantlets	23.6816
SRR767660	leaf	uninfected	fully developed	19.7765
SRR767669	leaf	2 days post infection by Venturia inaequalis	fully developed	179.105
SRR767670	leaf	4 days post infection by Venturia inaequalis	fully developed	21.0087
SRR767671	leaf	6 days post infection by Venturia inaequalis	fully developed	95.4107
SRR767672	leaf	8 days post infection by Venturia inaequalis	fully developed	18.9255
SRR767673	leaf	10 days post infection by Venturia inaequalis	fully developed	33.2118
SRR767674	leaf	12 days post infection by Venturia inaequalis	fully developed	24.5547
SRR768127	leaf	14 days post infection by Venturia inaequalis	fully developed	2.53149
SRR6308182	young leaf	no	immature leaves	70.0339
SRR3744769	leaf	no	mature	0.456806
SRR3744770	leaf	no	mature	0.319974
SRR3744771	leaf	no	mature	0.354267
SRR5405145	leaf	no	mature	15.4538
SRR6320561	leaf	no	mature	24.8598