Gene detail

Detail information of MD17G1181200 Annotation

Gene ID	Annotation
MD17G1181200	Insulinase (Peptidase family M16) protein

Network

Network Category	Global Network	Conditional network (different tissues and developmental stages)
Coexpression Positive	Top300 PCC genelist	Top300 PCC genelist
Coexpression Negative	Top300 PCC genelist	Top300 PCC genelist

Functional module

Method	Module ID	Function Annotation
Co-expression network	CFinderM0049	mitochondrial inner membrane mitochondrial respiratory chain complex III tricarboxylic acid cycle intracellular signal transduction mitochondrial transport Golgi apparatus protein targeting to vacuole response to chitin

Gene structure and chromatin state

more details in UCSC

details of chromatin state

Location

Gene	Type	Chr	Start	End	Strand
MD17G1181200	mRNA	Chr17	21107010	21111591	+

Sequences

CDS:

MD17G1181200

TTTGGTATAACATACTCTCATGTCACAAAATCCTTCTTCTTGGAACTTCACCGGCCCAGTAAATGAAGCCCAACACTAAATGTATCCAAGTTCATATCTCCGAAACTGCAATTCTTTTATTTCAACAGCCACTCTCTCTCTCTCTTGTTCTCCCAGAAAAAGCTCAAACCTTTAAAGAGGAACAGAGGCTGCAAAAGTCCCCAATCGGTTTTCTAGGGCTGCAATCAATCTTGAGCTTCCATCGCCATGTACAAAGCAGCCTCCCGACTCAGGTCCCTCAAGGGCCGTGGAACTTTGGGGGCCACCCGGTTTGCAACAAGTGCAGCTGTATCGAAGCCTTCATCTGGGGGTCTCTTTAGCTGGCTGACGGGGGAGAGCTCAAGTGCCCTTCCTCCTTTGGAAACCCAACTCCCAGGTGTTAACCTTCCTCCTCCAGTACCTGATTATGTTGAACCAAGCAAGACCCAGATTACAACTCTTTCTAATGGTGTCAAAATAGCTTCAGAAACTTCAACGAGTCCTGCAGCGTCCATTGGAATATATGTGGATTCTGGTTCCATATATGAGACACCAGTATCCAGTGGTGCCTCACACTTGCTAGAACGATTGGCTTTTAAGAGTACAACCAACCGGAGCCACTTACGCATTGTGAGAGAAGTGGAAGCAATCGGTGGTCACATAGGAGCCAGTGCCTCTAGGGAGCAAATGGGATATACTTTTGATGCTATCAAGACCTATGTTCCCCAGATGGTGGAACTACTTGTTGACTCTTTGAGGAACCCTGCCTTCTTGGAATGGGAAGTCAATGAAGAGCTCAATAAGGTGCAGGCAGAGATTGGAGAACTTTCTAAGAATCCGCAGGGCCTACTCTTGGAGGCGATTCATTCTGCTGGTTATTCTGGTGCATTGGCTAATCCTCTATTGGCTTCTGAATCATCACTAAACAGATTGAATGGCAGCATCTTGGAGCAGTTCATTGCTGAAAATTATACTGCTCCTCGTATAGTTCTTGCAGCATCTGGGGTTGATCATCAGGAGATTGTATCCATTGCAGAACCACTTCTCTCTGACCTACCGAGTGTGCCTCGCTTCGAGGAGCCACTATCCAAATATGTTGGAGGAGAGTTCCGTTGTCAAGCTGATACACCGGAAACACACGTAGCTCTTGCATTTGAGGTTCCCGGTGGCTGGCGGCAAGAGAAGCAAGCCGTCCTTTTGACAGTTCTCCAGTTGCTGATGGGAGGTGGTGGCTCTTTCTCTGCTGGGGGCCCTGGAAAGGGGATGCACTCAAGGCTATATCTCCGCGTCTTGAATCAGTATCCACAGATCCAATCCTTTTCTGCATTCAACAGCATATTCAATGATTCTGGGTTGTTTGGTATTTGTGCTAGCACTGGCTCTGAATTTGCATCGAAAGCAGTTGATATAGCAGCACAGGAATTACTTACAATTGCAACACCTGGACAAGTTACGGATGTACAGCTCAAACGTGCCAAGGAGTCGACAAAGGCTGCAGTTTTAATGAATCTAGAATCTAGAATGATTGCATCTGAGGATATAGGAAGGCAGGTTTTGACATACGGAGAGAGGAAACCTGTGGAGCACTTCTTGAAGACAGTGGAAGGAGTGACGTTGAAAGACATTACTACAATCGCGCAGAAGATTATCTCTTCACCTCTAACACTGGCAACATATGGCAATGTTGTACATGTACCGGGTTACGACTCAATTAGCAGCAGGTTCCATGCAAAATGAGAGGGTGCCTCTGCTGCCTGTTGGCTGTAATTTTTTGAATCGCGTGGCTACTCACGGCTTCCAAGCTATTCGCCTTTGTTGGCATTTGTCGAAATAAAATTTTGAAAGGTTAATTTGATCCAAATTACTTTCATGTATGATCAGGATTCGTTTTGGCAATATTATTTCTTTCCTCTCTCTGCGGGAGAGAGAAACCCTTGTTTTTTGTATGTTAATATTTGTTAAAATTAAGAAACACTTAGTATTACGGTCTAGTATTCCTTTTCACTTGTAAATGAGAGGTTTTAGGTTTGATTTTCGCTAAAGATGAATTTGAATCACATTATTGCTATCCCATAGTGAGATTAAACT

Protein:

Gene family

Gene family	Subfamily
--	--

Orthologous genes

Species	Gene ID	Score of Inparanoid	Annotation
Arabidopsis thaliana	AT3G16480.1	1	MPPalpha\|mitochondrial processing peptidase alpha subunit
Prunus persica	Prupe.3G056700.1.p	1	Insulinase (Peptidase family M16) protein
Pyrus x bretschneideri	Pbr029764.1	1	-
Rosa multiflora	Rmu_sc0004769.1_g000017.1	1	-
Rosa multiflora	Rmu_sc0012897.1_g000005.1	1	-
Rubus occidentalis	Ro06_G28372	1	-
Vitis vinifera	GSVIVT01016955001	1	Insulinase (Peptidase family M16) protein
Solanum lycopersicum	Solyc12g008630.1.1	1	Insulinase (Peptidase family M16) protein
Populus trichocarpa	Potri.001G191100.1	1	Insulinase (Peptidase family M16) protein
Nicotiana benthamiana	Niben101Scf00551g01027.1	1	Mitochondrial-processing peptidase subunit alpha
Oryza sativa	LOC_Os01g53700.1	1	"mitochondrial-processing peptidase subunit, mitochondrialprecursor, putative, expressed"
Oryza sativa	LOC_Os05g44916.1	1	"mitochondrial-processing peptidase subunit, mitochondrialprecursor, putative, expressed"
Zea mays	GRMZM2G005036_P01	1	Putative mitochondrial processing peptidase alpha subunit family protein;

Gene Ontology

GO term	Description	Category
GO:0004222	metalloendopeptidase activity	molecular_function
GO:0006508	proteolysis	biological_process
GO:0046872	metal ion binding	molecular_function

KEGG

KO	Description	Enzyme
K01412	mitochondrial-processing peptidase subunit alpha	EC:3.4.24.64

Pfam domain

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF05193.17	Peptidase_M16_C	240	418	6.10E-31

Expression pattern

SRA Experiment	Tissue	Stress	Stage	FPKM
SRR768136	whole seedling	no	seedling	41.8177
SRR5252888	dormant buds	no	dormant buds(0 month)	26.792
SRR5252889	dormant buds	no	dormant buds(0 month)	24.4863
SRR5252886	dormant buds	no	dormant buds(1 months)	30.4175
SRR5252887	dormant buds	no	dormant buds(1 months)	38.3827
SRR5252884	dormant buds	no	dormant buds(2 months)	29.5975
SRR5252882	dormant buds	no	dormant buds(3 months)	29.8534
SRR5252883	dormant buds	no	dormant buds(3 months)	29.9114
SRR5252880	dormant buds	no	dormant buds(4 months)	25.1649
SRR5252881	dormant buds	no	dormant buds(4 months)	26.9978
SRR5252878	bud break	no	bud break	26.1548
SRR5252879	bud break	no	bud break	41.9239
SRR3744766	flower	no	mature	42.3737
SRR3744767	flower	no	mature	41.1225
SRR3744768	flower	no	mature	43.6096
SRR6308190	stigmas	no	open flowers	47.9514
SRR6308181	styles	no	open flowers	56.6639
SRR6308188	filaments	no	open flowers	68.9337
SRR6308187	anthers	no	buds 1-3 days prior to flower opening	124.64
SRR6308192	pollen	no	open flowers	459.375
SRR6308191	petals	no	open flowers	63.9402
SRR6308194	sepals	no	open flowers	57.6455
SRR6308193	receptacles	no	open flowers	64.9168
SRR6308189	ovaries	no	open flowers	49.8781
SRR3384922	fruit	no	1 week after full bloom	39.4729
SRR3384921	fruit	no	2 week after full bloom	39.4798
SRR3384920	fruit	no	3 week after full bloom	36.5308
SRR3384919	fruit	no	4 week after full bloom	47.3044
SRR3384923	fruit	no	5 week after full bloom	40.8543
SRR3384918	fruit	no	6 week after full bloom	35.2501
SRR3384917	fruit	no	8 week after full bloom	33.6271
SRR3384916	fruit	no	10 week after full bloom	36.1621
SRR3384915	fruit	no	12 week after full bloom	38.1323
SRR3384914	fruit	no	14 week after full bloom	39.4775
SRR3384913	fruit	no	16 week after full bloom	48.3633
SRR3384912	fruit	no	18 week after full bloom	50.4635
SRR3384911	fruit	no	19 week after full bloom	59.3146
SRR3384910	fruit	no	20 week after full bloom	66.6552
SRR768128	whole fruit	no	25 days post anthesis	37.7169
SRR768129	whole fruit	no	35 days post anthesis	65.4447
SRR768130	whole fruit	no	60 days post anthesis	36.6039
SRR768131	whole fruit	no	87 days post anthesis	48.2491
SRR7343308	immature fruit flesh	no	immature	41.4915
SRR7343309	immature fruit flesh	no	immature	43.716
SRR6320494	ripe fruit flesh	no	mature	52.9888
SRR5405143	ripe fruit peel	no	mature	47.5533
SRR6320572	ripe fruit peel	no	mature	28.5887
SRR7403504	fruit	uninfected	mature	40.8196
SRR7403506	fruit	uninfected	mature	40.1078
SRR7403507	fruit	uninfected	mature	39.5055
SRR7403500	fruit	infected with penicillium expansum	mature	203.574
SRR7403501	fruit	infected with penicillium expansum	mature	199.801
SRR7403508	fruit	infected with penicillium expansum	mature	210.686
SRR7403502	fruit	infected with penicillium expansum	mature	190.367
SRR7403503	fruit	infected with penicillium expansum	mature	186.44
SRR7403505	fruit	infected with penicillium expansum	mature	189.665
SRR1613973	Central seeds	no	20DAPF	43.879
SRR1613974	Central seeds	no	20DAPF	41.8378
SRR1613975	Central seeds	no	20DAPF	41.181
SRR1613976	Lateral seeds	no	20DAPF	43.2302
SRR1613977	Lateral seeds	no	20DAPF	41.7656
SRR1613978	Lateral seeds	no	20DAPF	44.2446
SRR3744786	stem	no	mature	24.4879
SRR3744787	stem	no	mature	25.1486
SRR3744772	stem	no	mature	24.0853
SRX765691	seedling shoot apex	no	4-6 week old seedling	41.8519
SRX765683	tree shoot apex	no	Adult (tree), new shoot has 10-12 visible leaves	46.0722
SRR1089478	leaf	Virus-free	plantlets	19.9167
SRR1089477	leaf	ASGV-infected	plantlets	20.992
SRR767660	leaf	uninfected	fully developed	27.535
SRR767669	leaf	2 days post infection by Venturia inaequalis	fully developed	22.6614
SRR767670	leaf	4 days post infection by Venturia inaequalis	fully developed	28.177
SRR767671	leaf	6 days post infection by Venturia inaequalis	fully developed	29.8882
SRR767672	leaf	8 days post infection by Venturia inaequalis	fully developed	16.4466
SRR767673	leaf	10 days post infection by Venturia inaequalis	fully developed	28.7391
SRR767674	leaf	12 days post infection by Venturia inaequalis	fully developed	25.954
SRR768127	leaf	14 days post infection by Venturia inaequalis	fully developed	22.3217
SRR6308182	young leaf	no	immature leaves	59.0604
SRR3744769	leaf	no	mature	24.994
SRR3744770	leaf	no	mature	24.9949
SRR3744771	leaf	no	mature	26.4497
SRR5405145	leaf	no	mature	22.5758
SRR6320561	leaf	no	mature	24.0446