Gene detail

Detail information of MD07G1213300 Annotation

Gene ID	Annotation
MD07G1213300	Laccase/Diphenol oxidase family protein

Network

Network Category	Global Network	Conditional network (different tissues and developmental stages)
Coexpression Positive	Top300 PCC genelist	Top300 PCC genelist
Coexpression Negative	Top300 PCC genelist	Top300 PCC genelist

Functional module

Method	Module ID	Function Annotation
Co-expression network	CFinderM0408	plant-type secondary cell wall biogenesis glucuronoxylan biosynthetic process xylem development tRNA wobble adenosine to inosine editing rhamnogalacturonan I side chain metabolic process tRNA-specific adenosine deaminase activity xylosyltransferase activity galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity glucuronoxylan glucuronosyltransferase activity Golgi apparatus glucuronoxylan metabolic process xylan biosynthetic process galacturonosyltransferase 12/13/14/15 [EC:2.4.1.-]

Gene structure and chromatin state

more details in UCSC

details of chromatin state

Location

Gene	Type	Chr	Start	End	Strand
MD07G1213300	mRNA	Chr07	29100838	29103879	+

Sequences

CDS:

MD07G1213300

ACAACAGCAATTCACACACATCTGAGAGCTCCTTAGCAAACATGGAGTTCTTGGGGCTTCAATTTCGAACAATGTTGTTCTTGGTTGCCTTCTTGTATCCCGCATTCGTCGAGTCCTTGATTCGACACTATGAATTCAGTGTGGTCTACAAGGACACAACAAATCTTTGTTCCTCGAAGCCCATCGTCACCGTAAACGGGAAGTTCCCCGGACCAACCCTCTACGCAAGGGAAGATGATACTGTAATTGTAAAGGTCACCAACCATGTGAAATACAATGTCACAATCCACTGGCATGGGGTGAAGCAACGTGGAACAGGTTGGTCAGATGGGCCAGCATACATCACACAATGCCCCATACAGCCCGGCCGAAACTACATCTACAATTTCACACTTACAGGCCAAAGAGGCACACTTCTTTGGCATGCACACGACTCTTGGCTAAGGGCCACTCTACACGGTGCTATTGTCATCTTGCCTAAGAGAGGCACTCCTTACCCTTTTCCCACACCTGATGAGGAAAAAATTATCATCATGGCTGAATGGTGGAAATCAGATGTTGAAGATGTGATCAATCAAGCTACACAGTCTGGCCTGCCACCAAATGTCTCAGATGCACACACCATCAATGGCCGCGTAGGACCACTTCCTGGTTGCTCTTCTCAGGGGGGCTACACTTTACATGTTGAAAGTGACAAGACCTACATGCTACGCATCGTGAACGCTGCGCTAAACGATGAATTGTTCTTCAAGGTAGCAGGGCACAGCCTAACCGTTGTAGAAGTCGATGCCTCCTACACCAAGCCGTTCCAAACTGACACAATATACACCGGTCCAGGTCAAACCACAAACGCAATTCTAACAGCAAACCAGGGGATTGGCAAGTACTTCATAACAGCGTCTCCTTTCATGGACGCGCCAATTGGGTTCGACAACGCAACTGTGATCGCTACTTTGCGCTACAAAGGCACCCCGGCAAATCCCACAGCTATCTTAACCAGCATTCCTCCTCGCAATGCAACCCCGTTAACAGACGCTTTTGTTGACTCCCTTCGAAGCCTCAATTCGAAACAATACCCAGCCGATGTCCCATTAACTATAGACCATTCGCTTTTCTTCACCATTTCAGTTGGTGCAAATCCATGTGCTACATGTGTCAGTGGAAGCAAACTAGTATCTGCCTTCAACAATGTTAGCTTTGTGATGCCAAGTATCTCTCTCCTTCAAGCATATTACTACAATGTAAAGGGAGTCTACACACTTGATTTTCCGGCAAACCCTCCAATTCCTTTTAATTACACCGGCACATCTCCGGCAAACCTTCAGACCACAAACGGGACAAGACTATACCGGCTGGAGTATAATTCGACGGTTCAGATTGTGTTGCAAGGCACTGCTATCATAGCACCAGAGAGCCATCCAACCCATCTTCATGGATTCAATTTCTTTGTGGTTGGGAAAGGATTAGGTAATTTTGATCCAAAAAAGGACCCAGGAAAATTTAATCTTGTTGACCCAGTTGAGAGGAACACAGTATCAGTACCTACTGCTGGATGGACTGCAATCAGATTCAGGGCAAATAATCCAGGCATTTGGTTCCTGCATTGTCACCTGGAAGTTCACACATCATGGGGGCTGAAGATGGCATTCTTAGTGGAAAACGGAGAAGGACAAAACGAGTCTCTGCCACCACCTCCGACTGATCTTCCAACTTGCTAGAATTTCCAATCCGAACGCCTTTTGAATCGAGGTTGGAGACTCGAGACATCGAAAGAGTGAGTGTTCCAGGTAGAATATGAACTGAATTGACACAATTGAAAAGGTGGTTTGGTACAGGGAATGAAATAGAAGCAGTTGCTTAAAAGAGTGAATAAGTTTGTCAATTTTTGAATTTCTTGTACTTTGTCAAATTTTTGTGTTGAATTTAGTTTCACACCTATATATAATAAATATTTGGTCTGTAAGAATTTCTATAGTATCTTCTTGATGATTAATTTTTT

Protein:

Gene family

Gene family	Subfamily
--	--

Orthologous genes

Species	Gene ID	Score of Inparanoid	Annotation
Prunus persica	Prupe.2G245800.1.p	1	Laccase/Diphenol oxidase family protein
Pyrus communis	PCP029315.1	1	-
Pyrus x bretschneideri	Pbr011352.1	1	-
Rosa multiflora	Rmu_sc0001482.1_g000010.1	1	-
Rubus occidentalis	Ro07_G07818	1	-
Fragaria vesca	mrna20911.1	1	Laccase/Diphenol oxidase family protein
Vitis vinifera	GSVIVT01016372001	1	Laccase/Diphenol oxidase family protein
Populus trichocarpa	Potri.010G193100.1	1	Laccase/Diphenol oxidase family protein
Populus trichocarpa	Potri.008G064000.1	1	Laccase/Diphenol oxidase family protein

Gene Ontology

GO term	Description	Category
GO:0048046	apoplast	cellular component
GO:0052716	hydroquinone:oxygen oxidoreductase activity	molecular_function
GO:0046274	lignin catabolic process	biological_process
GO:0055114	oxidation-reduction process	biological_process
GO:0005507	copper ion binding	molecular_function

KEGG

KO	Description	Enzyme
K05909	laccase	EC:1.10.3.2

Pfam domain

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF07732.11	Cu-oxidase_3	36	147	9.60E-41
PF00394.18	Cu-oxidase	160	309	7.90E-40
PF07731.10	Cu-oxidase_2	409	541	1.70E-39

Expression pattern

SRA Experiment	Tissue	Stress	Stage	FPKM
SRR768136	whole seedling	no	seedling	2.60272
SRR5252888	dormant buds	no	dormant buds(0 month)	0.372029
SRR5252889	dormant buds	no	dormant buds(0 month)	0.430976
SRR5252886	dormant buds	no	dormant buds(1 months)	0.21004
SRR5252887	dormant buds	no	dormant buds(1 months)	0.0558077
SRR5252884	dormant buds	no	dormant buds(2 months)	0
SRR5252882	dormant buds	no	dormant buds(3 months)	0.0893874
SRR5252883	dormant buds	no	dormant buds(3 months)	0
SRR5252880	dormant buds	no	dormant buds(4 months)	0
SRR5252881	dormant buds	no	dormant buds(4 months)	0
SRR5252878	bud break	no	bud break	0
SRR5252879	bud break	no	bud break	0.0985307
SRR3744766	flower	no	mature	0.223476
SRR3744767	flower	no	mature	0.0976949
SRR3744768	flower	no	mature	0.179641
SRR6308190	stigmas	no	open flowers	0.0712281
SRR6308181	styles	no	open flowers	10.4809
SRR6308188	filaments	no	open flowers	0
SRR6308187	anthers	no	buds 1-3 days prior to flower opening	0.28487
SRR6308192	pollen	no	open flowers	0
SRR6308191	petals	no	open flowers	0.314588
SRR6308194	sepals	no	open flowers	0.152434
SRR6308193	receptacles	no	open flowers	0
SRR6308189	ovaries	no	open flowers	8.05397
SRR3384922	fruit	no	1 week after full bloom	0
SRR3384921	fruit	no	2 week after full bloom	0
SRR3384920	fruit	no	3 week after full bloom	0
SRR3384919	fruit	no	4 week after full bloom	0
SRR3384923	fruit	no	5 week after full bloom	0.0350356
SRR3384918	fruit	no	6 week after full bloom	0
SRR3384917	fruit	no	8 week after full bloom	0
SRR3384916	fruit	no	10 week after full bloom	0
SRR3384915	fruit	no	12 week after full bloom	0
SRR3384914	fruit	no	14 week after full bloom	0
SRR3384913	fruit	no	16 week after full bloom	0
SRR3384912	fruit	no	18 week after full bloom	0
SRR3384911	fruit	no	19 week after full bloom	0
SRR3384910	fruit	no	20 week after full bloom	0
SRR768128	whole fruit	no	25 days post anthesis	0.0504043
SRR768129	whole fruit	no	35 days post anthesis	0.0553514
SRR768130	whole fruit	no	60 days post anthesis	0.464009
SRR768131	whole fruit	no	87 days post anthesis	0
SRR7343308	immature fruit flesh	no	immature	0
SRR7343309	immature fruit flesh	no	immature	0
SRR6320494	ripe fruit flesh	no	mature	0
SRR5405143	ripe fruit peel	no	mature	0
SRR6320572	ripe fruit peel	no	mature	0
SRR7403504	fruit	uninfected	mature	0
SRR7403506	fruit	uninfected	mature	0
SRR7403507	fruit	uninfected	mature	0
SRR7403500	fruit	infected with penicillium expansum	mature	0
SRR7403501	fruit	infected with penicillium expansum	mature	0
SRR7403508	fruit	infected with penicillium expansum	mature	0
SRR7403502	fruit	infected with penicillium expansum	mature	0
SRR7403503	fruit	infected with penicillium expansum	mature	0
SRR7403505	fruit	infected with penicillium expansum	mature	0
SRR1613973	Central seeds	no	20DAPF	0.0125053
SRR1613974	Central seeds	no	20DAPF	0.0257743
SRR1613975	Central seeds	no	20DAPF	0.0233284
SRR1613976	Lateral seeds	no	20DAPF	0
SRR1613977	Lateral seeds	no	20DAPF	0
SRR1613978	Lateral seeds	no	20DAPF	0.0435909
SRR3744786	stem	no	mature	0
SRR3744787	stem	no	mature	0
SRR3744772	stem	no	mature	0
SRX765691	seedling shoot apex	no	4-6 week old seedling	7.49591
SRX765683	tree shoot apex	no	Adult (tree), new shoot has 10-12 visible leaves	16.1192
SRR1089478	leaf	Virus-free	plantlets	0.644391
SRR1089477	leaf	ASGV-infected	plantlets	0.249924
SRR767660	leaf	uninfected	fully developed	0.7355
SRR767669	leaf	2 days post infection by Venturia inaequalis	fully developed	0
SRR767670	leaf	4 days post infection by Venturia inaequalis	fully developed	0.118423
SRR767671	leaf	6 days post infection by Venturia inaequalis	fully developed	0
SRR767672	leaf	8 days post infection by Venturia inaequalis	fully developed	0
SRR767673	leaf	10 days post infection by Venturia inaequalis	fully developed	4.25781
SRR767674	leaf	12 days post infection by Venturia inaequalis	fully developed	1.3621
SRR768127	leaf	14 days post infection by Venturia inaequalis	fully developed	0
SRR6308182	young leaf	no	immature leaves	9.08826
SRR3744769	leaf	no	mature	0.0195958
SRR3744770	leaf	no	mature	0.0411853
SRR3744771	leaf	no	mature	0.0202677
SRR5405145	leaf	no	mature	4.01159
SRR6320561	leaf	no	mature	2.5365