Gene detail

Detail information of MD11G1008900 Annotation

Gene ID	Annotation
MD11G1008900	O-Glycosyl hydrolases family 17 protein

Network

Network Category	Global Network	Conditional network (different tissues and developmental stages)
Coexpression Positive	Top300 PCC genelist	Top300 PCC genelist
Coexpression Negative	Top300 PCC genelist	Top300 PCC genelist

Functional module

Method	Module ID	Function Annotation
Co-expression network	CFinderM0075	anchored component of plasma membrane leucocyanidin oxygenase activity

Gene structure and chromatin state

more details in UCSC

details of chromatin state

Location

Gene	Type	Chr	Start	End	Strand
MD11G1008900	mRNA	Chr11	739599	743584	+

Sequences

CDS:

MD11G1008900

GGTTTCTGTAGGGTCTGGATACTAGAAATGTGGGTTTAGTGCTCTTCTGGCTTCCACATTTGAGGGAGTTACTTTTTTAACTTTAAGCAAATGAACAATCTTTCTTAGATCCTTGGTTCTAGGCGCTTCGGTTTCTTGTGTGCCTTACTGTTTTTCTTAGCTGGTTTGAATCGTTGGAAGTAAACTTTGTGGCTGCTTTGCAGCTGGGGAAGTTGAATCGGCTTAGGACTTACGAGCTAACCGCAAGACACTGGAGGTGTAATTTGAAGTTTTATTAGCACGAATGATGCGTGAAAAATGGATTGGAGGCGTGCTTCTCCTTCTAGTTGGCATGTTTACTGATGTACAAGGTGCATTCATAGGGATAAACATTGGGACCGATGTTTCGGACCTTCCATCTGAGACAGATACAGTTGCACTCCTTAAAGCCCATCAAATTACACATGTGCGCCTCTACAATGCTGATGCTCACATACTGAAAGCCCTTTCAAACAGTGGAATTGAAGTAATGGTAGGTATCACAAATGAGGAAGTCCTAAGTGTTGGAGAGTCTTCATCAGCAGCAGCTGCCTGGATTAACAAAAATGTTGCAGCTTATTTGCCCTCAACCAATATTACCGCCATTGCTGTTGGCAGTGAGGTCATTACCTCAATCCCTCATGCTGCGCCAGTTTTGGTCGATGCTATGAACTACCTTCATAAAGCCTTAGTTGCTTCAAACCTAAATTTTCAGGTCAAAGTTTCAACTCCACAATCCATGGATATAATCCCAAAGCCTTTCCCCCCGTCCACTGCCACCTTTAATTACTCATGGGGACACACCATTTACCAAATCCTTCAGTTTATTAAAAACACGAATTCCTATTACATGCTAAATGCGTATCCTTATTATGGTTACACCAATGGGGATGGAATTTTCCCGCTTGATTATGCTCTTTTCCGACCACTTCCCTCTGTCAAGCAGATTGTTGACCCGAACACTGTTTTCCACTATAACAGCATGTTTGATGCTATGGTGGACGCCACCTATTATTCTATAGAGGATTTCAATTTCTCTGGGATCTCTGTTGTTGTCACCGAGACTGGTTGGCCATGGTTTGGCGGATCCAAAGAGCCCGATGCCAACACAGGAAATGCTCAGACCTACACCAATAATTTGATTCGACGAGTTTTAAATGATTCAGGTCCACCCAGCCAGCCAAAGTTGCCCATCAACACGTACATTTACGAGTTGTTCAACGAAGACAAGAGGCCAGGGCCAGTGTCAGAGAAAAACTGGGGTGTGCTGTATACGAATGGGTCTGCTGTGTATCCTTTAAGTTTGAGTGATTCCAGTCAAATTACTGGGAATTCTTCAGGGGTTTTCTGCACGGCGAAAGCTAATGCAGATCCAGATAAGTTGCAGGATGGCATAAACTGGGCTTGTGGGCAAGGTGGGGCTAACTGCACTCCCATTCAACGAGGGCAGCGGTGTTATCTCCCCGATACTATTGTAAATCATGCTTCATATGCTTATAATGACTATTATCAAAAGATGAAAAGTGCTGGCGGAACATGTGACTTTGATGACACCGCCATAATATCTACTGTTGATCCAAGCTATGGCGCGTGTAAATTTTCCGGAAGTTCTAATTCAAGCAAATTTACGGGACTTACACCAGCGTCAGTTGCACCTTCAACCGCTGTTGGAGGCTGGAGTTCGAATCGACAAGTTTCCAATCTTCAATATCTCATTCCGGCAGCATTTCTCGCATTGCTATTGCTTTGACTTGAGGTTCCATCCAGTTTACTTTTACCGTGGAGCGTAGTTATAGAACCACATTCGAGATATCAAAATGATTGAAGAAGACCCGGGAGGCGTATGACAGCACAAGCTTGGTGACACAATTGGAAATGTCCGCACGTTGTTTCATTAATTTGGCTTATGTTTCCAACTTCTGAGGTTGTCTCCTTCACCTCTGCAAATTCTCGGGAGTTTTGTGTAGTTCGTTTTGCAGGCATTTCTGATGTAGTGGTTAGACCTTGATTTTTTCGGACCAACTTAACTAGAACTTCATTTGTACCTTATCAATGAAAAACTAATTCTATCCTCCCCGCAACCAATTTTTCATTGTTTGCACATATAACATAATCCGTATTGAAGTA

Protein:

Gene family

Gene family	Subfamily
Carbohydrate-Active enzymes Family	GH17
Carbohydrate-Active enzymes Family	CBM43

Orthologous genes

Species	Gene ID	Score of Inparanoid	Annotation
Arabidopsis thaliana	AT3G13560.3	1	O-Glycosyl hydrolases family 17 protein
Arabidopsis thaliana	AT3G13560.2	1	O-Glycosyl hydrolases family 17 protein
Arabidopsis thaliana	AT3G13560.1	1	O-Glycosyl hydrolases family 17 protein
Pyrus communis	PCP035013.1	1	-
Pyrus x bretschneideri	Pbr003360.2	1	-
Rosa multiflora	Rmu_sc0002900.1_g000005.1	1	-
Fragaria vesca	mrna24806.1	1	O-Glycosyl hydrolases family 17 protein
Populus trichocarpa	Potri.001G006500.2	1	O-Glycosyl hydrolases family 17 protein
Populus trichocarpa	Potri.003G218500.4	0.623	O-Glycosyl hydrolases family 17 protein
Nicotiana benthamiana	Niben101Scf03889g01014.1	1	"Glucan endo-1,3-beta-glucosidase 4"
Oryza sativa	LOC_Os07g38930.1	1	"glucan endo-1,3-beta-glucosidase precursor, putative, expressed"
Zea mays	GRMZM2G072526_P01	1	"Glucan endo-1,3-beta-glucosidase 4 "
Zea mays	GRMZM2G113420_P01	0.892	-

Gene Ontology

GO term	Description	Category
GO:0005975	carbohydrate metabolic process	biological_process
GO:0003824	catalytic activity	molecular_function

KEGG

KO	Description	Enzyme
K19892	"glucan endo-1,3-beta-glucosidase 4"	EC:3.2.1.39

Pfam domain

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00332.14	Glyco_hydro_17	26	345	1.80E-79
PF07983.9	X8	361	431	4.10E-19

Expression pattern

SRA Experiment	Tissue	Stress	Stage	FPKM
SRR768136	whole seedling	no	seedling	5.94784
SRR5252888	dormant buds	no	dormant buds(0 month)	2.52191
SRR5252889	dormant buds	no	dormant buds(0 month)	4.29372
SRR5252886	dormant buds	no	dormant buds(1 months)	6.60133
SRR5252887	dormant buds	no	dormant buds(1 months)	6.60322
SRR5252884	dormant buds	no	dormant buds(2 months)	2.14202
SRR5252882	dormant buds	no	dormant buds(3 months)	4.21404
SRR5252883	dormant buds	no	dormant buds(3 months)	3.55648
SRR5252880	dormant buds	no	dormant buds(4 months)	3.21608
SRR5252881	dormant buds	no	dormant buds(4 months)	3.8443
SRR5252878	bud break	no	bud break	8.21361
SRR5252879	bud break	no	bud break	8.4249
SRR3744766	flower	no	mature	2.92287
SRR3744767	flower	no	mature	2.4196
SRR3744768	flower	no	mature	2.59095
SRR6308190	stigmas	no	open flowers	2.50467
SRR6308181	styles	no	open flowers	3.40368
SRR6308188	filaments	no	open flowers	14.124
SRR6308187	anthers	no	buds 1-3 days prior to flower opening	0.615194
SRR6308192	pollen	no	open flowers	0
SRR6308191	petals	no	open flowers	4.58538
SRR6308194	sepals	no	open flowers	4.58467
SRR6308193	receptacles	no	open flowers	11.6447
SRR6308189	ovaries	no	open flowers	6.951
SRR3384922	fruit	no	1 week after full bloom	28.4652
SRR3384921	fruit	no	2 week after full bloom	38.2217
SRR3384920	fruit	no	3 week after full bloom	32.807
SRR3384919	fruit	no	4 week after full bloom	27.312
SRR3384923	fruit	no	5 week after full bloom	17.3912
SRR3384918	fruit	no	6 week after full bloom	18.675
SRR3384917	fruit	no	8 week after full bloom	9.94157
SRR3384916	fruit	no	10 week after full bloom	13.5235
SRR3384915	fruit	no	12 week after full bloom	12.4807
SRR3384914	fruit	no	14 week after full bloom	9.31111
SRR3384913	fruit	no	16 week after full bloom	4.24969
SRR3384912	fruit	no	18 week after full bloom	4.37406
SRR3384911	fruit	no	19 week after full bloom	2.83795
SRR3384910	fruit	no	20 week after full bloom	0.579662
SRR768128	whole fruit	no	25 days post anthesis	31.4114
SRR768129	whole fruit	no	35 days post anthesis	43.0412
SRR768130	whole fruit	no	60 days post anthesis	16.8179
SRR768131	whole fruit	no	87 days post anthesis	9.81718
SRR7343308	immature fruit flesh	no	immature	17.8139
SRR7343309	immature fruit flesh	no	immature	19.1372
SRR6320494	ripe fruit flesh	no	mature	0
SRR5405143	ripe fruit peel	no	mature	0.127288
SRR6320572	ripe fruit peel	no	mature	0
SRR7403504	fruit	uninfected	mature	0
SRR7403506	fruit	uninfected	mature	0
SRR7403507	fruit	uninfected	mature	0
SRR7403500	fruit	infected with penicillium expansum	mature	0
SRR7403501	fruit	infected with penicillium expansum	mature	0
SRR7403508	fruit	infected with penicillium expansum	mature	0
SRR7403502	fruit	infected with penicillium expansum	mature	0.0459434
SRR7403503	fruit	infected with penicillium expansum	mature	0
SRR7403505	fruit	infected with penicillium expansum	mature	0
SRR1613973	Central seeds	no	20DAPF	8.06056
SRR1613974	Central seeds	no	20DAPF	10.3287
SRR1613975	Central seeds	no	20DAPF	8.0254
SRR1613976	Lateral seeds	no	20DAPF	9.10544
SRR1613977	Lateral seeds	no	20DAPF	8.13
SRR1613978	Lateral seeds	no	20DAPF	6.95383
SRR3744786	stem	no	mature	2.58252
SRR3744787	stem	no	mature	2.83412
SRR3744772	stem	no	mature	2.00663
SRX765691	seedling shoot apex	no	4-6 week old seedling	15.3987
SRX765683	tree shoot apex	no	Adult (tree), new shoot has 10-12 visible leaves	15.1529
SRR1089478	leaf	Virus-free	plantlets	9.31131
SRR1089477	leaf	ASGV-infected	plantlets	5.77815
SRR767660	leaf	uninfected	fully developed	1.81393
SRR767669	leaf	2 days post infection by Venturia inaequalis	fully developed	0.477652
SRR767670	leaf	4 days post infection by Venturia inaequalis	fully developed	4.60252
SRR767671	leaf	6 days post infection by Venturia inaequalis	fully developed	1.95254
SRR767672	leaf	8 days post infection by Venturia inaequalis	fully developed	0
SRR767673	leaf	10 days post infection by Venturia inaequalis	fully developed	2.56041
SRR767674	leaf	12 days post infection by Venturia inaequalis	fully developed	1.14577
SRR768127	leaf	14 days post infection by Venturia inaequalis	fully developed	1.83082
SRR6308182	young leaf	no	immature leaves	13.8923
SRR3744769	leaf	no	mature	0.506663
SRR3744770	leaf	no	mature	0.988352
SRR3744771	leaf	no	mature	0.804251
SRR5405145	leaf	no	mature	2.11935
SRR6320561	leaf	no	mature	2.44437