Gene detail

Detail information of GWHGAAZE000023

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002515179.1	3.08869E-30	conserved hypothetical protein [Ricinus communis]
COG	YP_007093377.1	3E-19	protein translocase subunit secA
Swissprot	tr\|Q9SYI0\|SECA1_ARATH	1E-31	Protein translocase subunit SECA1, chloroplastic (Precursor)
trEMBL	tr\|M4C9N6\|M4C9N6_BRARP	8E-31	Protein translocase subunit SecA {ECO:0000256\|RuleBase:RU003874}
TAIR10	AT4G01800.1	1E-27	Albino or Glassy Yellow 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	784246	784973	-
GWHAAZE00000001	mRNA	784246	784973	-
GWHAAZE00000001	exon	784246	784437	-
GWHAAZE00000001	exon	784938	784973	-
GWHAAZE00000001	CDS	784938	784973	-
GWHAAZE00000001	CDS	784246	784437	-

Transcript Sequence
>GWHTAAZE000023 ATGTTACAAGTAGCTCTGATTTCTCCTGTCCACAAGAGTGTTGATGAGCTTGTTTTGAGGGGTTTCAATTACTGTGTGATCGATGAGGTTGACTCCATCCTTATTGATGAAGCAAGAACTCCTCTCATAATATCAGGACCTGCTGAAAAACCAAGTGAGATGTACTATAAAGCTGCTAAGATTGGCGCAGCTTTTGAGCGAGATATTCATTACACCGTAAGAAAGTGA

Network for GWHGAAZE000023

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF07517.15	SecA_DEAD	11	66	9.60E-18

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03070	secA	Protein export	map03060
		Bacterial secretion system	map03070
		Quorum sensing	map02024

Gene Ontology

GO term	Ontology	Name
GO:0017038	biological_process	protein import
GO:0016020	cellular_component	membrane
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	16.514
	SRR3591706	second leaf	39.275
	SRR3591707	mature leaf	49.377
	SRR3591708	Shoot apex	14.816
	SRR3591709	Stem	11.799
	SRR3591710	White floral bud	20.976
	SRR3591711	White flower	26.602
	SRR3591712	Green floral bud	20.807
	SRR3591713	Yellow flower	22.523
SRP173429	SRR8316895	Juvenile bud stage	12.174
	SRR8316896	Juvenile bud stage	13.602
	SRR8316897	Juvenile bud stage	12.026
	SRR8316894	Third green stage	9.783
	SRR8316900	Third green stage	21.427
	SRR8316901	Third green stage	14.437
	SRR8316898	Complete white stage	5.871
	SRR8316899	Complete white stage	14.293
	SRR8316903	Complete white stage	13.711
	SRR8316902	Silver flowering stage	7.724
	SRR8316904	Silver flowering stage	18.032
	SRR8316905	Silver flowering stage	6.775
	SRR8316906	Gold flowering stage	23.063
	SRR8316907	Gold flowering stage	20.244
	SRR8316908	Gold flowering stage	23.677
SRP132670	SRR6706286	Control	8.090
	SRR6706287	Light intensity 50%	8.702
	SRR6706288	Light intensity 20%	9.872
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	5.533
	CNS0095593	Slightly white alabastrum(diploid) 2	2.941
	CNS0095594	Slightly white alabastrum(diploid) 3	2.666
	CNS0095595	Whole white alabastrum(diploid) 2	3.854
	CNS0095596	Whole white alabastrum(diploid) 3	2.899
	CNS0095597	Whole white alabastrum(diploid) 4	4.274
	CNS0095598	Silvery flower (diploied) 1	10.694
	CNS0095599	Silvery flower (diploied) 2	7.129
	CNS0095600	Silvery flower (diploied) 3	17.966
	CNS0095601	Golden flower (diploid) 1	11.006
	CNS0095602	Golden flower (diploid) 2	18.025
	CNS0095603	Golden flower (diploid) 3	19.011
	CNS0095604	Slightly white alabastrum(tetraploid) 1	8.502
	CNS0095605	Slightly white alabastrum(tetraploid) 2	7.372
	CNS0095606	Slightly white alabastrum(tetraploid) 3	13.781
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.826
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.602
	CNS0095609	Whole white alabastrum(tetraploid) 3	25.244
	CNS0095610	Silvery flower (diploied) 1	32.494
	CNS0095611	Silvery flower (diploied) 2	34.695
	CNS0095612	Silvery flower (diploied) 3	27.631
	CNS0095613	Golden flower (tetraploid) 1	16.693
	CNS0095614	Golden flower (tetraploid) 2	27.309
	CNS0095615	Golden flower (tetraploid) 3	24.354
CRA001975	CRR073297	Stem 1	6.983
	CRR073298	Stem 2	5.201
	CRR073299	Stem 3	3.123
	CRR073300	Leaf 1	5.171
	CRR073301	Leaf 2	3.982
	CRR073302	Leaf 3	3.565
	CRR073303	Juvenile bud 1	1.939
	CRR073304	Juvenile bud 2	1.446
	CRR073305	Juvenile bud 3	2.974
	CRR073306	Third green 1	1.089
	CRR073307	Third green 2	0.959
	CRR073308	Third green 3	2.581
	CRR073309	Second white 1	5.572
	CRR073310	Second white 2	5.294
	CRR073311	Second white 3	2.573
	CRR073312	Silver flowering 1	3.393
	CRR073313	Silver flowering 2	2.944
	CRR073314	Silver flowering 3	4.100
	CRR073315	Gold flowering 1	3.187
	CRR073316	Gold flowering 2	11.951
	CRR073317	Gold flowering 3	10.320
	CRR073318	Tawny withering 1	0.796
	CRR073319	Tawny withering 2	1.435
	CRR073320	Tawny withering 3	1.467