Gene detail

Detail information of GWHGAAZE000024

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004166186.1	1.54817E-95	PREDICTED: protein translocase subunit SECA1, chloroplastic-like, partial [Cucumis sativus]
COG	YP_007062222.1	2E-62	protein translocase subunit secA
Swissprot	tr\|Q9SYI0\|SECA1_ARATH	4E-90	Protein translocase subunit SECA1, chloroplastic (Precursor)
trEMBL	tr\|F6HZF9\|F6HZF9_VITVI	2E-95	Protein translocase subunit SecA {ECO:0000256\|RuleBase:RU003874}
TAIR10	AT4G01800.2	5E-74	Albino or Glassy Yellow 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	790721	794088	-
GWHAAZE00000001	mRNA	790721	794088	-
GWHAAZE00000001	exon	794048	794088	-
GWHAAZE00000001	exon	793663	793924	-
GWHAAZE00000001	exon	791536	791608	-
GWHAAZE00000001	exon	790721	790950	-
GWHAAZE00000001	CDS	794048	794088	-
GWHAAZE00000001	CDS	793663	793924	-
GWHAAZE00000001	CDS	791536	791608	-
GWHAAZE00000001	CDS	790721	790950	-

Transcript Sequence
>GWHTAAZE000024 ATGGCTATGGGGGCGGTGGCACCGCCATTCGAGTCGTTCAACACTTTGCTTGATTTACCCCAATCTCGCTCAATAAGAGGGCTGAGATTGCGTCCTCCAGCAGCATTGGGAGGTTTATTGGGGGGTTTATTTAAGGGCACAGATACCGGGGAATCCACCAGACAGCAATATGCCCCCACTGTTCAACTCATTAATCGCTTTGAAGCTGAGCTTTCCCCTTTGTCCGATTCCCAATTGAGGGAAAGGTCTTCTCTTTTGAAGGAGCGTGCTCGCCTCGGCGAATCTTTGGATTCCCTTTTACCTGAAGCATTTGCTGTTGTGAGAGAGGCTTCGAAAAGAGTTCTAGGTCTTCGTCCTTTTGATGTGCAACTGATAGGTGGTATGGTGCTTCATAGGGGAGAAATTGCTGAAATGAGGACTGGAGAAGGAAAGACACTTGTTGCTATATTACCAGCTTATTTAAATGCATTAAGTGGGAAAGGAGTTCATGTTGTTACTGTCAATGATTATTTGGCACGGCGAGATTGTGAGTGGGTTGGTCAAGTTCCCCGGTTTCTTGGACTGACAATTGGCCTGATCCAACGTATGACTCCCATCTTTAATTAA

Network for GWHGAAZE000024

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF07517.15	SecA_DEAD	50	196	4.20E-60

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03070	secA	Protein export	map03060
		Bacterial secretion system	map03070
		Quorum sensing	map02024

Gene Ontology

GO term	Ontology	Name
GO:0017038	biological_process	protein import
GO:0006605	biological_process	protein targeting
GO:0006886	biological_process	intracellular protein transport
GO:0016020	cellular_component	membrane
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	23.087
	SRR3591706	second leaf	44.339
	SRR3591707	mature leaf	56.573
	SRR3591708	Shoot apex	15.001
	SRR3591709	Stem	11.127
	SRR3591710	White floral bud	24.963
	SRR3591711	White flower	33.804
	SRR3591712	Green floral bud	16.575
	SRR3591713	Yellow flower	33.847
SRP173429	SRR8316895	Juvenile bud stage	11.144
	SRR8316896	Juvenile bud stage	18.769
	SRR8316897	Juvenile bud stage	9.368
	SRR8316894	Third green stage	8.277
	SRR8316900	Third green stage	21.887
	SRR8316901	Third green stage	19.786
	SRR8316898	Complete white stage	6.503
	SRR8316899	Complete white stage	16.026
	SRR8316903	Complete white stage	16.442
	SRR8316902	Silver flowering stage	8.233
	SRR8316904	Silver flowering stage	16.106
	SRR8316905	Silver flowering stage	7.662
	SRR8316906	Gold flowering stage	22.354
	SRR8316907	Gold flowering stage	21.864
	SRR8316908	Gold flowering stage	29.652
SRP132670	SRR6706286	Control	48.333
	SRR6706287	Light intensity 50%	51.437
	SRR6706288	Light intensity 20%	51.266
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.433
	CNS0095593	Slightly white alabastrum(diploid) 2	3.491
	CNS0095594	Slightly white alabastrum(diploid) 3	2.881
	CNS0095595	Whole white alabastrum(diploid) 2	3.062
	CNS0095596	Whole white alabastrum(diploid) 3	1.742
	CNS0095597	Whole white alabastrum(diploid) 4	3.214
	CNS0095598	Silvery flower (diploied) 1	11.714
	CNS0095599	Silvery flower (diploied) 2	8.967
	CNS0095600	Silvery flower (diploied) 3	22.549
	CNS0095601	Golden flower (diploid) 1	8.831
	CNS0095602	Golden flower (diploid) 2	22.813
	CNS0095603	Golden flower (diploid) 3	23.133
	CNS0095604	Slightly white alabastrum(tetraploid) 1	7.652
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.513
	CNS0095606	Slightly white alabastrum(tetraploid) 3	15.715
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.798
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.382
	CNS0095609	Whole white alabastrum(tetraploid) 3	22.917
	CNS0095610	Silvery flower (diploied) 1	40.538
	CNS0095611	Silvery flower (diploied) 2	35.455
	CNS0095612	Silvery flower (diploied) 3	30.663
	CNS0095613	Golden flower (tetraploid) 1	15.595
	CNS0095614	Golden flower (tetraploid) 2	31.410
	CNS0095615	Golden flower (tetraploid) 3	27.984
CRA001975	CRR073297	Stem 1	16.587
	CRR073298	Stem 2	14.257
	CRR073299	Stem 3	12.865
	CRR073300	Leaf 1	12.595
	CRR073301	Leaf 2	11.910
	CRR073302	Leaf 3	7.749
	CRR073303	Juvenile bud 1	6.182
	CRR073304	Juvenile bud 2	6.353
	CRR073305	Juvenile bud 3	10.329
	CRR073306	Third green 1	4.802
	CRR073307	Third green 2	4.972
	CRR073308	Third green 3	6.428
	CRR073309	Second white 1	6.427
	CRR073310	Second white 2	8.303
	CRR073311	Second white 3	8.731
	CRR073312	Silver flowering 1	9.098
	CRR073313	Silver flowering 2	4.451
	CRR073314	Silver flowering 3	5.637
	CRR073315	Gold flowering 1	11.956
	CRR073316	Gold flowering 2	23.404
	CRR073317	Gold flowering 3	6.987
	CRR073318	Tawny withering 1	3.994
	CRR073319	Tawny withering 2	5.647
	CRR073320	Tawny withering 3	3.805