Gene detail

Detail information of GWHGAAZE000523

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	EYU46071.1	1.63888E-94	hypothetical protein MIMGU_mgv1a013446mg [Erythranthe guttata]
Swissprot	tr\|P23993\|PSAL_HORVU	1E-85	Photosystem I reaction center subunit XI, chloroplastic (Precursor)
trEMBL	tr\|A0A022S1E3\|A0A022S1E3_ERYGU	6E-95	Uncharacterized protein {ECO:0000313\|EMBL:EYU46071.1}
TAIR10	AT4G12800.1	2E-66	photosystem I subunit l

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	10402651	10403145	-
GWHAAZE00000001	mRNA	10402651	10403145	-
GWHAAZE00000001	exon	10402651	10403145	-
GWHAAZE00000001	CDS	10402651	10403145	-

Transcript Sequence
>GWHTAAZE000525 CAGCCCACTTATCAAGTGATCCAGCCCATCAATGGCGATCCCTTCATCGGAAGTCTTGAAACTCCGGTCACATCGAGTCCACTGATCGCGTGGTACCTCTCCAACCTCCCGGCCTATCGTACCGCAGTGAGCCCACTACTCCGCGGGGTTGAAGTGGGGCTGGCCCATGGATTCCTCTTAGTGGGCCCATTCGTAAAGACGGGCCCACTGAGGAACACACCCTATGCAGGGGAAGCAGGGTCTCTAGCAGCTGGTGGGCTTGTAGCCATACTAACCCTTTGCTTGACAATCTATGGGATCTCGTCATTCAAAGAAGGAGAGCCGTCGATTGCACCATCGTTGACTTTGACCGGAAGGAAGAAGGTGCCAGATCAGCTTCAAACTTCGGATGGGTGGGCCAAGTTTACTGGTGGGTTCTTCTTTGGTGGGGTCTCTGGTGTCATTTGGGCTTATTTTTTGCTCTATGTTCTTAACCTTCCTTACTATGTTAAATAG

Network for GWHGAAZE000523

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02605.16	PsaL	6	157	1.40E-58

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02699	psaL	Photosynthesis	map00195

Gene Ontology

GO term	Ontology	Name
GO:0015979	biological_process	photosynthesis
GO:0009522	cellular_component	photosystem I
GO:0009538	cellular_component	photosystem I reaction center

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	256.960
	SRR3591706	second leaf	1524.964
	SRR3591707	mature leaf	1418.657
	SRR3591708	Shoot apex	520.740
	SRR3591709	Stem	208.014
	SRR3591710	White floral bud	28.111
	SRR3591711	White flower	46.381
	SRR3591712	Green floral bud	28.694
	SRR3591713	Yellow flower	9.382
SRP173429	SRR8316895	Juvenile bud stage	56.918
	SRR8316896	Juvenile bud stage	37.860
	SRR8316897	Juvenile bud stage	21.690
	SRR8316894	Third green stage	14.975
	SRR8316900	Third green stage	14.504
	SRR8316901	Third green stage	14.745
	SRR8316898	Complete white stage	3.138
	SRR8316899	Complete white stage	15.077
	SRR8316903	Complete white stage	12.343
	SRR8316902	Silver flowering stage	1.430
	SRR8316904	Silver flowering stage	4.933
	SRR8316905	Silver flowering stage	0.769
	SRR8316906	Gold flowering stage	1.702
	SRR8316907	Gold flowering stage	3.858
	SRR8316908	Gold flowering stage	3.003
SRP132670	SRR6706286	Control	23.367
	SRR6706287	Light intensity 50%	17.663
	SRR6706288	Light intensity 20%	15.901
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	78.769
	CNS0095593	Slightly white alabastrum(diploid) 2	60.091
	CNS0095594	Slightly white alabastrum(diploid) 3	73.998
	CNS0095595	Whole white alabastrum(diploid) 2	34.364
	CNS0095596	Whole white alabastrum(diploid) 3	31.294
	CNS0095597	Whole white alabastrum(diploid) 4	23.950
	CNS0095598	Silvery flower (diploied) 1	154.673
	CNS0095599	Silvery flower (diploied) 2	152.924
	CNS0095600	Silvery flower (diploied) 3	32.911
	CNS0095601	Golden flower (diploid) 1	139.625
	CNS0095602	Golden flower (diploid) 2	75.462
	CNS0095603	Golden flower (diploid) 3	82.959
	CNS0095604	Slightly white alabastrum(tetraploid) 1	51.829
	CNS0095605	Slightly white alabastrum(tetraploid) 2	68.481
	CNS0095606	Slightly white alabastrum(tetraploid) 3	71.286
	CNS0095607	Whole white alabastrum(tetraploid) 1	53.931
	CNS0095608	Whole white alabastrum(tetraploid) 2	18.666
	CNS0095609	Whole white alabastrum(tetraploid) 3	21.141
	CNS0095610	Silvery flower (diploied) 1	26.229
	CNS0095611	Silvery flower (diploied) 2	42.455
	CNS0095612	Silvery flower (diploied) 3	24.496
	CNS0095613	Golden flower (tetraploid) 1	15.511
	CNS0095614	Golden flower (tetraploid) 2	37.075
	CNS0095615	Golden flower (tetraploid) 3	35.401
CRA001975	CRR073297	Stem 1	58.948
	CRR073298	Stem 2	42.683
	CRR073299	Stem 3	97.811
	CRR073300	Leaf 1	7.294
	CRR073301	Leaf 2	7.024
	CRR073302	Leaf 3	15.740
	CRR073303	Juvenile bud 1	3.082
	CRR073304	Juvenile bud 2	3.678
	CRR073305	Juvenile bud 3	4.268
	CRR073306	Third green 1	1.823
	CRR073307	Third green 2	3.425
	CRR073308	Third green 3	5.501
	CRR073309	Second white 1	5.629
	CRR073310	Second white 2	4.497
	CRR073311	Second white 3	2.962
	CRR073312	Silver flowering 1	1.864
	CRR073313	Silver flowering 2	2.410
	CRR073314	Silver flowering 3	0.865
	CRR073315	Gold flowering 1	1401.727
	CRR073316	Gold flowering 2	1097.437
	CRR073317	Gold flowering 3	1272.503
	CRR073318	Tawny withering 1	75.011
	CRR073319	Tawny withering 2	82.753
	CRR073320	Tawny withering 3	74.426