Gene detail

Detail information of GWHGAAZE000567

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AGE10592.1	5.8167E-141	cinnamate 4-hydroxylase [Lonicera japonica]
Swissprot	tr\|O24312\|TCMO_POPTM	3E-133	Trans-cinnamate 4-monooxygenase
trEMBL	tr\|L7ZB58\|L7ZB58_LONJA	2E-141	Cinnamate 4-hydroxylase {ECO:0000313\|EMBL:AGE10592.1}
TAIR10	AT2G30490.1	6E-84	cinnamate-4-hydroxylase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	11393996	11394604	+
GWHAAZE00000001	mRNA	11393996	11394604	+
GWHAAZE00000001	exon	11393996	11394604	+
GWHAAZE00000001	CDS	11393996	11394604	+

Transcript Sequence
>GWHTAAZE000569 ATGAAAATAGCGATTGAAACAACACTATGGTCAGTCGAGTGGGGAATCGCCGAGCTAGTAAACCACCAAGAGATCCAAAATAAGCTCCGGCATGAACTCGACACCGTGCTCGGACCGGGGGTCCAAATCACTGAGCCAGACACCCACAAGCTACCCTACCTCCAAGCTGTGATCAAAGAGACCCTACGCCTTCGCATGGCCATTCCCCTCCTGGTCCCACACATGAACCTTAATGATGCCAAACTTGGCAGTTATGACATTCCGGCCGAGAGCAAGATCTTGGTCAACGCGTGGTGGTTAGCCAACAACCCGGCTAAGTGGAAGAACCCGGAGGAGTTTAGGCCTGAGCGGTTCTTGGAAGAAGAGGCTAAGGTTGAGGCTAATGGGAATGACTTTAGGTACTTGCCCTTTGGCGTTGGGAGGAGGAGTTGCCCTGGTATTATACTTGCATTGCCGATTCTCGGGATTACCTTGGGGCGTTTGGTGCAGAATTTCGAGCTTTTGCCGCCACCTGGTCAGAATAAGATTGATACTACGGAGAAAGGAGGGCAGTTTAGTCTTCATATTTTGAAGCATTCCACGATTGTTGCCAAGCCGAGATCTTTTTGA

Network for GWHGAAZE000567

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00067.23	p450	5	192	3.30E-61

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00487	CYP73A	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Degradation of aromatic compounds	map01220
		Ubiquinone and other terpenoid-quinone biosynthesis	map00130
		Phenylpropanoid biosynthesis	map00940
		Stilbenoid, diarylheptanoid and gingerol biosynthesis	map00945
		Flavonoid biosynthesis	map00941

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0005506	molecular_function	iron ion binding
GO:0016705	molecular_function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	88.088
	SRR3591706	second leaf	278.947
	SRR3591707	mature leaf	269.840
	SRR3591708	Shoot apex	201.352
	SRR3591709	Stem	993.459
	SRR3591710	White floral bud	78.407
	SRR3591711	White flower	99.291
	SRR3591712	Green floral bud	43.359
	SRR3591713	Yellow flower	64.436
SRP173429	SRR8316895	Juvenile bud stage	106.787
	SRR8316896	Juvenile bud stage	106.789
	SRR8316897	Juvenile bud stage	26.444
	SRR8316894	Third green stage	21.705
	SRR8316900	Third green stage	54.402
	SRR8316901	Third green stage	67.813
	SRR8316898	Complete white stage	5.057
	SRR8316899	Complete white stage	38.992
	SRR8316903	Complete white stage	19.668
	SRR8316902	Silver flowering stage	5.517
	SRR8316904	Silver flowering stage	5.916
	SRR8316905	Silver flowering stage	3.217
	SRR8316906	Gold flowering stage	27.624
	SRR8316907	Gold flowering stage	27.526
	SRR8316908	Gold flowering stage	93.306
SRP132670	SRR6706286	Control	38.672
	SRR6706287	Light intensity 50%	42.297
	SRR6706288	Light intensity 20%	43.425
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	89.321
	CNS0095593	Slightly white alabastrum(diploid) 2	70.035
	CNS0095594	Slightly white alabastrum(diploid) 3	97.439
	CNS0095595	Whole white alabastrum(diploid) 2	56.222
	CNS0095596	Whole white alabastrum(diploid) 3	41.559
	CNS0095597	Whole white alabastrum(diploid) 4	52.462
	CNS0095598	Silvery flower (diploied) 1	67.857
	CNS0095599	Silvery flower (diploied) 2	75.190
	CNS0095600	Silvery flower (diploied) 3	18.095
	CNS0095601	Golden flower (diploid) 1	70.394
	CNS0095602	Golden flower (diploid) 2	44.492
	CNS0095603	Golden flower (diploid) 3	42.191
	CNS0095604	Slightly white alabastrum(tetraploid) 1	69.959
	CNS0095605	Slightly white alabastrum(tetraploid) 2	72.447
	CNS0095606	Slightly white alabastrum(tetraploid) 3	163.381
	CNS0095607	Whole white alabastrum(tetraploid) 1	58.222
	CNS0095608	Whole white alabastrum(tetraploid) 2	12.745
	CNS0095609	Whole white alabastrum(tetraploid) 3	58.780
	CNS0095610	Silvery flower (diploied) 1	19.281
	CNS0095611	Silvery flower (diploied) 2	12.674
	CNS0095612	Silvery flower (diploied) 3	16.391
	CNS0095613	Golden flower (tetraploid) 1	78.202
	CNS0095614	Golden flower (tetraploid) 2	90.426
	CNS0095615	Golden flower (tetraploid) 3	28.500
CRA001975	CRR073297	Stem 1	127.872
	CRR073298	Stem 2	95.318
	CRR073299	Stem 3	130.948
	CRR073300	Leaf 1	59.449
	CRR073301	Leaf 2	58.016
	CRR073302	Leaf 3	61.017
	CRR073303	Juvenile bud 1	38.255
	CRR073304	Juvenile bud 2	20.943
	CRR073305	Juvenile bud 3	27.883
	CRR073306	Third green 1	35.609
	CRR073307	Third green 2	15.030
	CRR073308	Third green 3	19.482
	CRR073309	Second white 1	20.017
	CRR073310	Second white 2	14.556
	CRR073311	Second white 3	18.504
	CRR073312	Silver flowering 1	60.782
	CRR073313	Silver flowering 2	75.786
	CRR073314	Silver flowering 3	77.725
	CRR073315	Gold flowering 1	47.157
	CRR073316	Gold flowering 2	62.456
	CRR073317	Gold flowering 3	61.472
	CRR073318	Tawny withering 1	149.431
	CRR073319	Tawny withering 2	151.023
	CRR073320	Tawny withering 3	244.353