Gene detail

Detail information of GWHGAAZE000635

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009624361.1	1.22909E-76	PREDICTED: SKP1-like protein 1A isoform X1 [Nicotiana tomentosiformis]
Swissprot	tr\|O49484\|ASK11_ARATH	1E-69	SKP1-like protein 11
trEMBL	tr\|M1AKL9\|M1AKL9_SOLTU	3E-74	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400024783}
TAIR10	AT4G34210.1	2E-55	SKP1-like 11

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	13022706	13023155	-
GWHAAZE00000001	mRNA	13022706	13023155	-
GWHAAZE00000001	exon	13022706	13023155	-
GWHAAZE00000001	CDS	13022706	13023155	-

Transcript Sequence
>GWHTAAZE000637 ATGATCGTGTTGCAGAGCTCCGACAAGGAGACGTTTGAGGTGGAAGAGGCGGTGGCCATGGAGTCTCAGACCATCAAGCACATGATAGAGGATGATTGCGTAGACACAAGTATTCCTCTACCAAACGTTACCAGCAAGACCTTGGCTAAGGTTATCGAGTACTGCAAGAAGCACATCGTCAAGGACAAGACCTGCGACCATGAGGAGGAGCTTAAGAAGTTTGACGTGGAGTTTATGAAAGGCTTGGATCAAGACACACTCTTCGATCTCATTTTGGCAGCAAACTATCTCAACATAAAGAGCCTGCTTGATTTGACGTGTCAAACAGTCGCGGACATGATCAAAGATAAGAGTCCGGAGGAAATTCGCAAGATATTTAACATCAAGAATGACTTTACTCCTGAGGAAGAGGATGCGGTCCGCCAGGAGAATGCTTGGGCTTTCGAGTGA

Network for GWHGAAZE000635

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03931.16	Skp1_POZ	1	58	3.80E-29
PF01466.20	Skp1	100	147	3.30E-28

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	SKP1

KEGG pathway

KO	Enzyme	pathway	mapID
K03094	SKP1, CBF3D	Protein processing in endoplasmic reticulum	map04141
		Ubiquitin mediated proteolysis	map04120
		Wnt signaling pathway	map04310
		Hedgehog signaling pathway - fly	map04341
		TGF-beta signaling pathway	map04350
		Cell cycle	map04110
		Cell cycle - yeast	map04111
		Oocyte meiosis	map04114
		Circadian rhythm	map04710

Gene Ontology

GO term	Ontology	Name
GO:0006511	biological_process	ubiquitin-dependent protein catabolic process

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.091
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	2.485
	SRR3591711	White flower	10.118
	SRR3591712	Green floral bud	2.861
	SRR3591713	Yellow flower	11.236
SRP173429	SRR8316895	Juvenile bud stage	1.742
	SRR8316896	Juvenile bud stage	1.661
	SRR8316897	Juvenile bud stage	0.907
	SRR8316894	Third green stage	0.659
	SRR8316900	Third green stage	4.073
	SRR8316901	Third green stage	3.973
	SRR8316898	Complete white stage	1.128
	SRR8316899	Complete white stage	6.529
	SRR8316903	Complete white stage	2.355
	SRR8316902	Silver flowering stage	2.665
	SRR8316904	Silver flowering stage	3.170
	SRR8316905	Silver flowering stage	1.609
	SRR8316906	Gold flowering stage	3.823
	SRR8316907	Gold flowering stage	5.436
	SRR8316908	Gold flowering stage	4.532
SRP132670	SRR6706286	Control	7.415
	SRR6706287	Light intensity 50%	6.370
	SRR6706288	Light intensity 20%	5.667
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.517
	CNS0095593	Slightly white alabastrum(diploid) 2	8.851
	CNS0095594	Slightly white alabastrum(diploid) 3	4.421
	CNS0095595	Whole white alabastrum(diploid) 2	6.499
	CNS0095596	Whole white alabastrum(diploid) 3	8.207
	CNS0095597	Whole white alabastrum(diploid) 4	5.761
	CNS0095598	Silvery flower (diploied) 1	5.668
	CNS0095599	Silvery flower (diploied) 2	2.971
	CNS0095600	Silvery flower (diploied) 3	3.980
	CNS0095601	Golden flower (diploid) 1	0.915
	CNS0095602	Golden flower (diploid) 2	2.497
	CNS0095603	Golden flower (diploid) 3	2.751
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.483
	CNS0095605	Slightly white alabastrum(tetraploid) 2	5.002
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.941
	CNS0095607	Whole white alabastrum(tetraploid) 1	4.223
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.696
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.573
	CNS0095610	Silvery flower (diploied) 1	6.586
	CNS0095611	Silvery flower (diploied) 2	2.369
	CNS0095612	Silvery flower (diploied) 3	5.253
	CNS0095613	Golden flower (tetraploid) 1	5.620
	CNS0095614	Golden flower (tetraploid) 2	1.527
	CNS0095615	Golden flower (tetraploid) 3	1.574
CRA001975	CRR073297	Stem 1	3.010
	CRR073298	Stem 2	6.110
	CRR073299	Stem 3	7.666
	CRR073300	Leaf 1	10.081
	CRR073301	Leaf 2	11.948
	CRR073302	Leaf 3	15.758
	CRR073303	Juvenile bud 1	16.945
	CRR073304	Juvenile bud 2	13.250
	CRR073305	Juvenile bud 3	16.914
	CRR073306	Third green 1	4.024
	CRR073307	Third green 2	9.103
	CRR073308	Third green 3	7.038
	CRR073309	Second white 1	6.281
	CRR073310	Second white 2	5.360
	CRR073311	Second white 3	3.188
	CRR073312	Silver flowering 1	3.262
	CRR073313	Silver flowering 2	10.106
	CRR073314	Silver flowering 3	6.288
	CRR073315	Gold flowering 1	3.240
	CRR073316	Gold flowering 2	1.479
	CRR073317	Gold flowering 3	1.742
	CRR073318	Tawny withering 1	3.614
	CRR073319	Tawny withering 2	7.350
	CRR073320	Tawny withering 3	2.240