Gene detail

Detail information of GWHGAAZE000863

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011089365.1	1.8377E-104	PREDICTED: NEDD8-specific protease 1 [Sesamum indicum]
Swissprot	tr\|Q9LSS7\|RUBP1_ARATH	4E-88	NEDD8-specific protease 1
trEMBL	tr\|A0A059ABJ7\|A0A059ABJ7_EUCGR	5E-101	Uncharacterized protein {ECO:0000313\|EMBL:KCW51432.1}
TAIR10	AT5G60190.1	5E-71	Cysteine proteinases superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	18294720	18295415	+
GWHAAZE00000001	mRNA	18294720	18295415	+
GWHAAZE00000001	exon	18294720	18295415	+
GWHAAZE00000001	CDS	18294720	18295415	+

Transcript Sequence
>GWHTAAZE000865 ATGCTTACAGTTGACATATACAACATGGCAAAATCCTCTGCTGATGATAAGATTCTAAGCTACAACGACGTTGTACTTAGACGATCCGATCTGACAATTCTAAGCGGCCTGCATTTTCTCAATGACCGCATAATAGAGTTTTATTTCAGTTACCTCACTTCATGCCACCCTTCTGAGTTCATCTTACTGGTCCCACCTACAATCTCCTTTTGGGTAACAAACTGCCAGGATCTTGAAAGCATCAAAGATTTCCTACAACCCCTAAATTTCCCCTGCAAGAAACTCGTTATCTTCCCCATCAATGACAACGATGACGTGGAAAAAGCAGAGGGTGGAAGTCATTGGAGCTTACTTGCATTTTATAGAGGAAAGAATGTGTTTGTGCATCACGATAGCTTTGGAGGCTCTAATAAGCGCTACGCCAAACGGCTATACGAAGCTCTTGTTCCATATATGGGAATCTCAGATGGGGCTTACGTTGAGTGTTCTAATACTCCCCAGCAAATGAATGGTTATGATTGCGGGTTATATGTTTTAGCCATTGCAAGAGCCATATGTTGTTGGTATGAAAGAGATGGGCCGAAGGATGAAGTGGATTTGTGGTTTACTTATGTGAAGGAGCAGGTTTCTCCATTGGTGGTTTTTGGTATGCGTAATGAGATTCTAGGGCTGATACGAAGCTTAGGGGCAATGTAA

Network for GWHGAAZE000863

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02902.20	Peptidase_C48	82	186	2.40E-13

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	ULP

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006508	biological_process	proteolysis
GO:0008234	molecular_function	cysteine-type peptidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	6.555
	SRR3591706	second leaf	2.654
	SRR3591707	mature leaf	7.609
	SRR3591708	Shoot apex	8.916
	SRR3591709	Stem	11.070
	SRR3591710	White floral bud	5.285
	SRR3591711	White flower	6.732
	SRR3591712	Green floral bud	3.988
	SRR3591713	Yellow flower	5.988
SRP173429	SRR8316895	Juvenile bud stage	6.567
	SRR8316896	Juvenile bud stage	8.586
	SRR8316897	Juvenile bud stage	6.455
	SRR8316894	Third green stage	3.754
	SRR8316900	Third green stage	10.748
	SRR8316901	Third green stage	9.833
	SRR8316898	Complete white stage	3.292
	SRR8316899	Complete white stage	9.198
	SRR8316903	Complete white stage	8.865
	SRR8316902	Silver flowering stage	5.260
	SRR8316904	Silver flowering stage	7.099
	SRR8316905	Silver flowering stage	3.954
	SRR8316906	Gold flowering stage	12.856
	SRR8316907	Gold flowering stage	12.238
	SRR8316908	Gold flowering stage	6.104
SRP132670	SRR6706286	Control	2.811
	SRR6706287	Light intensity 50%	4.066
	SRR6706288	Light intensity 20%	4.116
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	6.788
	CNS0095593	Slightly white alabastrum(diploid) 2	3.686
	CNS0095594	Slightly white alabastrum(diploid) 3	2.858
	CNS0095595	Whole white alabastrum(diploid) 2	6.504
	CNS0095596	Whole white alabastrum(diploid) 3	5.172
	CNS0095597	Whole white alabastrum(diploid) 4	7.611
	CNS0095598	Silvery flower (diploied) 1	9.523
	CNS0095599	Silvery flower (diploied) 2	9.132
	CNS0095600	Silvery flower (diploied) 3	16.169
	CNS0095601	Golden flower (diploid) 1	10.311
	CNS0095602	Golden flower (diploid) 2	17.207
	CNS0095603	Golden flower (diploid) 3	15.064
	CNS0095604	Slightly white alabastrum(tetraploid) 1	9.412
	CNS0095605	Slightly white alabastrum(tetraploid) 2	6.652
	CNS0095606	Slightly white alabastrum(tetraploid) 3	7.873
	CNS0095607	Whole white alabastrum(tetraploid) 1	9.243
	CNS0095608	Whole white alabastrum(tetraploid) 2	7.296
	CNS0095609	Whole white alabastrum(tetraploid) 3	8.875
	CNS0095610	Silvery flower (diploied) 1	15.542
	CNS0095611	Silvery flower (diploied) 2	14.579
	CNS0095612	Silvery flower (diploied) 3	9.206
	CNS0095613	Golden flower (tetraploid) 1	8.614
	CNS0095614	Golden flower (tetraploid) 2	14.433
	CNS0095615	Golden flower (tetraploid) 3	16.386
CRA001975	CRR073297	Stem 1	7.354
	CRR073298	Stem 2	6.161
	CRR073299	Stem 3	3.822
	CRR073300	Leaf 1	7.219
	CRR073301	Leaf 2	4.040
	CRR073302	Leaf 3	2.337
	CRR073303	Juvenile bud 1	3.318
	CRR073304	Juvenile bud 2	4.225
	CRR073305	Juvenile bud 3	5.044
	CRR073306	Third green 1	1.181
	CRR073307	Third green 2	1.229
	CRR073308	Third green 3	1.621
	CRR073309	Second white 1	2.815
	CRR073310	Second white 2	1.964
	CRR073311	Second white 3	2.896
	CRR073312	Silver flowering 1	3.130
	CRR073313	Silver flowering 2	2.039
	CRR073314	Silver flowering 3	4.262
	CRR073315	Gold flowering 1	3.594
	CRR073316	Gold flowering 2	9.302
	CRR073317	Gold flowering 3	9.224
	CRR073318	Tawny withering 1	5.572
	CRR073319	Tawny withering 2	5.071
	CRR073320	Tawny withering 3	4.625