Gene detail

Detail information of GWHGAAZE001108

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AEF32083.1	2.25307E-45	ent-kaurene synthase [Castanea mollissima]
Swissprot	tr\|Q9SAK2\|KSB_ARATH	3E-37	Ent-kaur-16-ene synthase, chloroplastic (Precursor)
trEMBL	tr\|M1BZZ5\|M1BZZ5_SOLTU	7E-46	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400056851}
TAIR10	AT1G79460.1	8E-33	Terpenoid cyclases/Protein prenyltransferases superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	25208981	25209658	+
GWHAAZE00000001	mRNA	25208981	25209658	+
GWHAAZE00000001	exon	25208981	25209025	+
GWHAAZE00000001	exon	25209329	25209658	+
GWHAAZE00000001	CDS	25208981	25209025	+
GWHAAZE00000001	CDS	25209329	25209658	+

Transcript Sequence
>GWHTAAZE001110 ATGAGCAATTGTGGGCGCCTTCTCAATGATATCCAAAGCTTCAAGAGGGAATCCGAGCAAGGTAAACTGAATGCCATATCGTTGCGAATGATTCATGGTGGTGGGAGTACTACGAAAGAAGAGGCTATAGAAGACATGAGGAGGTTCGTGGAAACGCAGTGGGAAGAAGTGCTGAGGCTAGTACTGAAGGAGAAGGGGAGCGTGGTACCTAGAGCTTGCAAGGAGTTGTTTTGGAAAATGACAAAAGTTGTGCATCAGTTCTACCTCAAGGATGACGGTTTCACTTCCCAAGGACTGATGAGCGCCGTCAGGGATATTATTCATGAACCCGTTGCATTGCATGCCTTTGATGATGAGTTTCCAAATATAAGTTAG

Network for GWHGAAZE001108

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03936.17	Terpene_synth_C	1	56	2.10E-09

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K04121	E4.2.3.19	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Diterpenoid biosynthesis	map00904

Gene Ontology

GO term	Ontology	Name
GO:0000287	molecular_function	magnesium ion binding
GO:0010333	molecular_function	terpene synthase activity
GO:0016829	molecular_function	lyase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.244
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.086
	SRR3591709	Stem	0.825
	SRR3591710	White floral bud	0.276
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.300
	SRR3591713	Yellow flower	0.208
SRP173429	SRR8316895	Juvenile bud stage	1.381
	SRR8316896	Juvenile bud stage	3.487
	SRR8316897	Juvenile bud stage	0.116
	SRR8316894	Third green stage	0.764
	SRR8316900	Third green stage	1.764
	SRR8316901	Third green stage	3.110
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	1.249
	SRR8316903	Complete white stage	0.102
	SRR8316902	Silver flowering stage	0.223
	SRR8316904	Silver flowering stage	0.780
	SRR8316905	Silver flowering stage	0.207
	SRR8316906	Gold flowering stage	0.065
	SRR8316907	Gold flowering stage	0.491
	SRR8316908	Gold flowering stage	0.117
SRP132670	SRR6706286	Control	0.713
	SRR6706287	Light intensity 50%	0.901
	SRR6706288	Light intensity 20%	1.364
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.696
	CNS0095593	Slightly white alabastrum(diploid) 2	3.866
	CNS0095594	Slightly white alabastrum(diploid) 3	5.047
	CNS0095595	Whole white alabastrum(diploid) 2	4.177
	CNS0095596	Whole white alabastrum(diploid) 3	4.972
	CNS0095597	Whole white alabastrum(diploid) 4	4.312
	CNS0095598	Silvery flower (diploied) 1	2.656
	CNS0095599	Silvery flower (diploied) 2	1.880
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.999
	CNS0095602	Golden flower (diploid) 2	0.716
	CNS0095603	Golden flower (diploid) 3	0.680
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.219
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.169
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.238
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.071
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.208
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.054
	CNS0095610	Silvery flower (diploied) 1	0.000
	CNS0095611	Silvery flower (diploied) 2	0.144
	CNS0095612	Silvery flower (diploied) 3	0.114
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.906
	CRR073298	Stem 2	2.030
	CRR073299	Stem 3	2.021
	CRR073300	Leaf 1	2.804
	CRR073301	Leaf 2	1.490
	CRR073302	Leaf 3	1.012
	CRR073303	Juvenile bud 1	1.276
	CRR073304	Juvenile bud 2	0.370
	CRR073305	Juvenile bud 3	0.931
	CRR073306	Third green 1	0.372
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.100
	CRR073309	Second white 1	0.102
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.019
	CRR073312	Silver flowering 1	0.021
	CRR073313	Silver flowering 2	0.084
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.085
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	1.174
	CRR073319	Tawny withering 2	0.251
	CRR073320	Tawny withering 3	0.598