Gene detail

Detail information of GWHGAAZE001870

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008226211.1	2.52268E-52	PREDICTED: cytochrome P450 CYP72A219-like [Prunus mume]
COG	YP_001522424.1	0.000002	cytochrome P450 family protein
Swissprot	tr\|H2DH21\|C7A29_PANGI	3E-52	Cytochrome P450 CYP72A219
trEMBL	tr\|A1XEL4\|A1XEL4_TOBAC	3E-52	CYP72A57 {ECO:0000313\|EMBL:ABC69414.1}
TAIR10	AT3G14690.1	3E-36	cytochrome P450, family 72, subfamily A, polypeptide 15

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	63315511	63317537	-
GWHAAZE00000001	mRNA	63315511	63317537	-
GWHAAZE00000001	exon	63317330	63317537	-
GWHAAZE00000001	exon	63315511	63315749	-
GWHAAZE00000001	CDS	63317330	63317537	-
GWHAAZE00000001	CDS	63315511	63315749	-

Transcript Sequence
>GWHTAAZE001874 ATGTTTGATTTGTTGTGGGTGAGGCCCATGAAGAGAGACAAGTACCTCAGAAATCAAGGTTTCAAGGGAAGTTCTTACAGCCTTGTCTTTGGAGATACCAAAAGGATCAACACGATGATCAAACAAGCCAAGTCCAACCCCATCAATCTTTCCCATGATATTGTGCCACGTGTTGTCCCCTGGATGCATGATTCTATCCAGAAATATGGTAAGAATTTTTTCATATGGTTGGGGTCAGTACCAAGGGTGCACATAATGGAGCCAGAATTAATAAGGGAGATACTGAATAAGCATCAGATCTTCCAGAAGCCTAAGACAAATCCATTAATGAAGCTGTTTGTAGATGGACTGGCAACCCATGAGGAGGAAAAGTGGGCCAAACACAGGAAAATTATCAACCCTGCTTTCCATGTTGAGAAGTTAAAGGTTTTTTTTTTAACCTGTTTC

Network for GWHGAAZE001870

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00067.23	p450	65	141	1.90E-10

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08506	SYP7	SNARE interactions in vesicular transport	map04130

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0005506	molecular_function	iron ion binding
GO:0016705	molecular_function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.053
	SRR3591706	second leaf	0.130
	SRR3591707	mature leaf	0.093
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.092
	SRR3591710	White floral bud	7.692
	SRR3591711	White flower	0.084
	SRR3591712	Green floral bud	2.669
	SRR3591713	Yellow flower	0.312
SRP173429	SRR8316895	Juvenile bud stage	0.185
	SRR8316896	Juvenile bud stage	0.250
	SRR8316897	Juvenile bud stage	0.502
	SRR8316894	Third green stage	0.114
	SRR8316900	Third green stage	2.915
	SRR8316901	Third green stage	0.451
	SRR8316898	Complete white stage	0.061
	SRR8316899	Complete white stage	0.172
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.680
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	4.217
SRP132670	SRR6706286	Control	1.878
	SRR6706287	Light intensity 50%	3.660
	SRR6706288	Light intensity 20%	4.233
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.227
	CNS0095593	Slightly white alabastrum(diploid) 2	0.053
	CNS0095594	Slightly white alabastrum(diploid) 3	0.173
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.074
	CNS0095597	Whole white alabastrum(diploid) 4	0.099
	CNS0095598	Silvery flower (diploied) 1	0.382
	CNS0095599	Silvery flower (diploied) 2	1.389
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.251
	CNS0095603	Golden flower (diploid) 3	0.467
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.467
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.112
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.610
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.776
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.430
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (diploied) 1	0.085
	CNS0095611	Silvery flower (diploied) 2	0.181
	CNS0095612	Silvery flower (diploied) 3	0.391
	CNS0095613	Golden flower (tetraploid) 1	0.080
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.026
CRA001975	CRR073297	Stem 1	0.250
	CRR073298	Stem 2	0.236
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.435
	CRR073301	Leaf 2	0.093
	CRR073302	Leaf 3	0.033
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.619
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.021
	CRR073307	Third green 2	3.570
	CRR073308	Third green 3	0.506
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.054
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.410
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.494
	CRR073319	Tawny withering 2	0.135
	CRR073320	Tawny withering 3	0.400