Gene detail

Detail information of GWHGAAZE001889

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002532988.1	6.83834E-50	conserved hypothetical protein [Ricinus communis]
Swissprot	tr\|C0LGE0\|Y1765_ARATH	3E-38	Probable LRR receptor-like serine/threonine-protein kinase At1g07650 (Precursor)
trEMBL	tr\|B9T419\|B9T419_RICCO	3E-50	Putative uncharacterized protein {ECO:0000313\|EMBL:EEF29396.1}
TAIR10	AT1G07650.2	8E-34	Leucine-rich repeat transmembrane protein kinase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	63796749	63797078	+
GWHAAZE00000001	mRNA	63796749	63797078	+
GWHAAZE00000001	exon	63796749	63797078	+
GWHAAZE00000001	CDS	63796749	63797078	+

Transcript Sequence
>GWHTAAZE001893 ATGGGATCCGAATATTCATCTGAGGAAGCTATGGTGATGCTAAATGTAGCCCTTTTGTGTACAAATGCAGCCCCAACACTTAGACCCACAATGTCCCAAGTGGTTAGCATGCTCGATGGCCGAACCGCAGTCCAAGATCTACTTTCCGATCCTGGGTTTTCGACCATCAATTCGAAATTCAGGGCTATAAGAAATCACTTCTGGCAGAATCCGAGCCAGACACTAAGCATGTCATCCAATGGTCCGTACACAGACTCGACTGCCTCGAACGTTGATAAAGAAGAAACTGGGATCCTAGTAAGAGTTAGTTCAACTGTATCAGATAAATGA

Network for GWHGAAZE001889

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0175	GO:0000159 protein phosphatase type 2A complex GOslim:cellular_component GO:0005634 nucleus GOslim:cellular_component Transcription factor HB-KNOX family Transcription factor HB-KNOX Ubiquitin_F-box family Ubiquitin_F-box family Transcription factor SET family Transcription factor SET

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03145.17	Sina	124	323	1.00E-78

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K04506	SIAH1	Ubiquitin mediated proteolysis	map04120
		MAPK signaling pathway - fly	map04013
		Wnt signaling pathway	map04310
		p53 signaling pathway	map04115

Gene Ontology

GO term	Ontology	Name
GO:0006511	biological_process	ubiquitin-dependent protein catabolic process
GO:0007275	biological_process	multicellular organism development
GO:0005634	cellular_component	nucleus
GO:0005515	molecular_function	protein binding
GO:0008270	molecular_function	zinc ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	9.556
	SRR3591706	second leaf	41.924
	SRR3591707	mature leaf	49.973
	SRR3591708	Shoot apex	23.529
	SRR3591709	Stem	7.057
	SRR3591710	White floral bud	6.376
	SRR3591711	White flower	10.611
	SRR3591712	Green floral bud	1.621
	SRR3591713	Yellow flower	2.486
SRP173429	SRR8316895	Juvenile bud stage	6.966
	SRR8316896	Juvenile bud stage	12.651
	SRR8316897	Juvenile bud stage	7.419
	SRR8316894	Third green stage	1.224
	SRR8316900	Third green stage	2.158
	SRR8316901	Third green stage	1.118
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	4.793
	SRR8316903	Complete white stage	2.766
	SRR8316902	Silver flowering stage	0.369
	SRR8316904	Silver flowering stage	0.043
	SRR8316905	Silver flowering stage	0.271
	SRR8316906	Gold flowering stage	0.648
	SRR8316907	Gold flowering stage	1.542
	SRR8316908	Gold flowering stage	0.564
SRP132670	SRR6706286	Control	2.773
	SRR6706287	Light intensity 50%	2.708
	SRR6706288	Light intensity 20%	2.742
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	18.080
	CNS0095593	Slightly white alabastrum(diploid) 2	20.057
	CNS0095594	Slightly white alabastrum(diploid) 3	13.185
	CNS0095595	Whole white alabastrum(diploid) 2	9.229
	CNS0095596	Whole white alabastrum(diploid) 3	1.109
	CNS0095597	Whole white alabastrum(diploid) 4	4.836
	CNS0095598	Silvery flower (diploied) 1	27.656
	CNS0095599	Silvery flower (diploied) 2	23.985
	CNS0095600	Silvery flower (diploied) 3	6.817
	CNS0095601	Golden flower (diploid) 1	33.222
	CNS0095602	Golden flower (diploid) 2	13.447
	CNS0095603	Golden flower (diploid) 3	11.671
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.049
	CNS0095605	Slightly white alabastrum(tetraploid) 2	11.686
	CNS0095606	Slightly white alabastrum(tetraploid) 3	8.996
	CNS0095607	Whole white alabastrum(tetraploid) 1	5.920
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.627
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.154
	CNS0095610	Silvery flower (diploied) 1	0.090
	CNS0095611	Silvery flower (diploied) 2	7.461
	CNS0095612	Silvery flower (diploied) 3	1.503
	CNS0095613	Golden flower (tetraploid) 1	1.383
	CNS0095614	Golden flower (tetraploid) 2	0.794
	CNS0095615	Golden flower (tetraploid) 3	0.317
CRA001975	CRR073297	Stem 1	5.227
	CRR073298	Stem 2	2.820
	CRR073299	Stem 3	2.889
	CRR073300	Leaf 1	0.445
	CRR073301	Leaf 2	2.112
	CRR073302	Leaf 3	0.307
	CRR073303	Juvenile bud 1	1.242
	CRR073304	Juvenile bud 2	0.429
	CRR073305	Juvenile bud 3	0.814
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	14.994
	CRR073316	Gold flowering 2	27.510
	CRR073317	Gold flowering 3	6.005
	CRR073318	Tawny withering 1	15.886
	CRR073319	Tawny withering 2	28.610
	CRR073320	Tawny withering 3	17.940