Gene detail

Detail information of GWHGAAZE001981

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009596955.1	7.20399E-81	PREDICTED: exocyst complex component EXO70B1-like isoform X3 [Nicotiana tomentosiformis]
Swissprot	tr\|Q9FGH9\|E70B1_ARATH	4E-35	Exocyst complex component EXO70B1
trEMBL	tr\|K4BC35\|K4BC35_SOLLC	5E-81	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc02g088800.1.1}
TAIR10	AT3G29400.1	3E-47	exocyst subunit exo70 family protein E1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	66332297	66332887	+
GWHAAZE00000001	mRNA	66332297	66332887	+
GWHAAZE00000001	exon	66332297	66332887	+
GWHAAZE00000001	CDS	66332297	66332887	+

Transcript Sequence
>GWHTAAZE001985 ATGCATTGCGAATGTGATGTTCAATTCAATTACGGTCGAGAGTGCTCTCAAGCATATATCAGTGTAAGAAAAAATGCCTTGGATGATTGCCTCTTCATTCTTGGAGCGGATAAATCGAGCATCGAGGACGTACTAAAGATGGAGTGGAGCACCTTGAAGTTCAAGGTTAGGAGATGGATATCGGCTATGAAGAATTTTGTGAGGGTCTATCTCGCGAGTGAAAAAAGGCTATGTGATCAGATTTTTGGGGAGCTCGAATCGGTTAGTCCAGTTTGTTTTACGGAGGCATCAAAGGCTTCTATATTGCAGCTTTTGAATTTTGGTGAAGCCATAGTCATCGGTCCTCACCAGCCTGAGAAGTTGCTGAGGATTCTTGATATGTATGAGGTGCTAGCCAATCTTATCCCGGATATTGATACTTTATATGCAGATGAGACCGGTACTTGCATTAGATTCGAGAGCCAGGACGTTTTGAGGCAATTGGGCGATTATGTAAAGTCGACATTTCTTAAATTCAAAACGCAGTTGCTTCAAATATTTCTACCGAACCTTTTGCTGGCGGTGGAATCCACTATCTTACCAGATATGTAA

Network for GWHGAAZE001981

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03081.16	Exo70	58	176	1.20E-31

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K17872	NDC1, ndbB	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Ubiquinone and other terpenoid-quinone biosynthesis	map00130
		Insulin signaling pathway	map04910

Gene Ontology

GO term	Ontology	Name
GO:0006887	biological_process	exocytosis
GO:0000145	cellular_component	exocyst

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.600
	SRR3591706	second leaf	2.780
	SRR3591707	mature leaf	3.071
	SRR3591708	Shoot apex	1.528
	SRR3591709	Stem	1.743
	SRR3591710	White floral bud	1.761
	SRR3591711	White flower	5.631
	SRR3591712	Green floral bud	4.358
	SRR3591713	Yellow flower	3.464
SRP173429	SRR8316895	Juvenile bud stage	2.433
	SRR8316896	Juvenile bud stage	3.048
	SRR8316897	Juvenile bud stage	1.443
	SRR8316894	Third green stage	1.949
	SRR8316900	Third green stage	6.806
	SRR8316901	Third green stage	6.295
	SRR8316898	Complete white stage	3.957
	SRR8316899	Complete white stage	12.048
	SRR8316903	Complete white stage	5.075
	SRR8316902	Silver flowering stage	3.941
	SRR8316904	Silver flowering stage	6.703
	SRR8316905	Silver flowering stage	2.391
	SRR8316906	Gold flowering stage	9.252
	SRR8316907	Gold flowering stage	8.427
	SRR8316908	Gold flowering stage	5.742
SRP132670	SRR6706286	Control	5.836
	SRR6706287	Light intensity 50%	5.132
	SRR6706288	Light intensity 20%	5.142
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.935
	CNS0095593	Slightly white alabastrum(diploid) 2	3.136
	CNS0095594	Slightly white alabastrum(diploid) 3	1.919
	CNS0095595	Whole white alabastrum(diploid) 2	2.470
	CNS0095596	Whole white alabastrum(diploid) 3	3.523
	CNS0095597	Whole white alabastrum(diploid) 4	2.544
	CNS0095598	Silvery flower (diploied) 1	6.019
	CNS0095599	Silvery flower (diploied) 2	2.521
	CNS0095600	Silvery flower (diploied) 3	9.906
	CNS0095601	Golden flower (diploid) 1	5.649
	CNS0095602	Golden flower (diploid) 2	8.751
	CNS0095603	Golden flower (diploid) 3	7.995
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.769
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.366
	CNS0095606	Slightly white alabastrum(tetraploid) 3	5.176
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.268
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.045
	CNS0095609	Whole white alabastrum(tetraploid) 3	5.403
	CNS0095610	Silvery flower (diploied) 1	5.215
	CNS0095611	Silvery flower (diploied) 2	4.428
	CNS0095612	Silvery flower (diploied) 3	4.741
	CNS0095613	Golden flower (tetraploid) 1	2.889
	CNS0095614	Golden flower (tetraploid) 2	4.302
	CNS0095615	Golden flower (tetraploid) 3	1.671
CRA001975	CRR073297	Stem 1	3.843
	CRR073298	Stem 2	6.301
	CRR073299	Stem 3	5.162
	CRR073300	Leaf 1	7.814
	CRR073301	Leaf 2	6.696
	CRR073302	Leaf 3	5.665
	CRR073303	Juvenile bud 1	7.195
	CRR073304	Juvenile bud 2	10.425
	CRR073305	Juvenile bud 3	9.128
	CRR073306	Third green 1	6.477
	CRR073307	Third green 2	5.126
	CRR073308	Third green 3	6.137
	CRR073309	Second white 1	7.706
	CRR073310	Second white 2	2.914
	CRR073311	Second white 3	6.318
	CRR073312	Silver flowering 1	2.832
	CRR073313	Silver flowering 2	3.192
	CRR073314	Silver flowering 3	1.703
	CRR073315	Gold flowering 1	8.766
	CRR073316	Gold flowering 2	11.648
	CRR073317	Gold flowering 3	9.622
	CRR073318	Tawny withering 1	4.530
	CRR073319	Tawny withering 2	5.419
	CRR073320	Tawny withering 3	5.620