Gene detail

Detail information of GWHGAAZE001982

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009596955.1	1.30265E-81	PREDICTED: exocyst complex component EXO70B1-like isoform X3 [Nicotiana tomentosiformis]
Swissprot	tr\|Q9LZD3\|E70A1_ARATH	1E-30	Exocyst complex component EXO70A1
trEMBL	tr\|K4BC35\|K4BC35_SOLLC	1E-80	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc02g088800.1.1}
TAIR10	AT5G61010.2	9E-42	exocyst subunit exo70 family protein E2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	66333142	66333615	+
GWHAAZE00000001	mRNA	66333142	66333615	+
GWHAAZE00000001	exon	66333142	66333615	+
GWHAAZE00000001	CDS	66333142	66333615	+

Transcript Sequence
>GWHTAAZE001986 ATGAACAACATACATTACATGGCTGAAAAGGTTAAAGATTCGGAGCTAAGAACCATCTTTGGGGATGGGTGGATTCGCAAGCATAATTGGAGTGTACAACAGCACGCAATGAACTATGAGAGAGCTACTTGGAGTTCGATCCTCTCATTACTTAAAGATGAGGGTATTTGGAATCTGGGCTCAAACTCCGTGTCGAAAACTCTTCTCAAAGAGAGGCTGCAGAGATTTTATATCGCGTTTGAAGAGGTTTACAAGAACCAGACGTCGTGGTTAGTACCAGCTATTCATCTTCGAGAAGATCTAAGAATCTCAACATCGATCAAGGTAATTCATGCTTACTACACTTTTGTGGGAAGGCATAGCAACCATGTTAGCGATCGGCACATTAAGTACACAGCTGATGATCTCGAGATTTTCCTCTTGGATTTCTTTGAGGGATCTCCAAGATCATTACACAGTTTCCACAGGAGGTGA

Network for GWHGAAZE001982

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03081.16	Exo70	1	141	2.60E-46
PF07714.18	PK_Tyr_Ser-Thr	71	344	2.00E-47

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_RLCK-VIII

KEGG pathway

KO	Enzyme	pathway	mapID
K07195	EXOC7, EXO70	Insulin signaling pathway	map04910
K07195	EXOC7, EXO70	Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0006887	biological_process	exocytosis
GO:0006468	biological_process	protein phosphorylation
GO:0000145	cellular_component	exocyst
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.966
	SRR3591706	second leaf	2.464
	SRR3591707	mature leaf	4.918
	SRR3591708	Shoot apex	2.381
	SRR3591709	Stem	1.139
	SRR3591710	White floral bud	2.842
	SRR3591711	White flower	9.067
	SRR3591712	Green floral bud	3.915
	SRR3591713	Yellow flower	4.186
SRP173429	SRR8316895	Juvenile bud stage	1.959
	SRR8316896	Juvenile bud stage	1.736
	SRR8316897	Juvenile bud stage	0.860
	SRR8316894	Third green stage	1.523
	SRR8316900	Third green stage	4.061
	SRR8316901	Third green stage	3.598
	SRR8316898	Complete white stage	2.239
	SRR8316899	Complete white stage	9.438
	SRR8316903	Complete white stage	3.472
	SRR8316902	Silver flowering stage	2.935
	SRR8316904	Silver flowering stage	3.487
	SRR8316905	Silver flowering stage	1.871
	SRR8316906	Gold flowering stage	5.772
	SRR8316907	Gold flowering stage	3.511
	SRR8316908	Gold flowering stage	2.048
SRP132670	SRR6706286	Control	1.018
	SRR6706287	Light intensity 50%	0.997
	SRR6706288	Light intensity 20%	1.070
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.787
	CNS0095593	Slightly white alabastrum(diploid) 2	2.061
	CNS0095594	Slightly white alabastrum(diploid) 3	4.435
	CNS0095595	Whole white alabastrum(diploid) 2	4.392
	CNS0095596	Whole white alabastrum(diploid) 3	2.338
	CNS0095597	Whole white alabastrum(diploid) 4	3.895
	CNS0095598	Silvery flower (diploied) 1	3.962
	CNS0095599	Silvery flower (diploied) 2	4.703
	CNS0095600	Silvery flower (diploied) 3	4.845
	CNS0095601	Golden flower (diploid) 1	4.153
	CNS0095602	Golden flower (diploid) 2	7.070
	CNS0095603	Golden flower (diploid) 3	4.940
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.335
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.409
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.348
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.908
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.854
	CNS0095609	Whole white alabastrum(tetraploid) 3	3.276
	CNS0095610	Silvery flower (diploied) 1	3.546
	CNS0095611	Silvery flower (diploied) 2	3.518
	CNS0095612	Silvery flower (diploied) 3	2.746
	CNS0095613	Golden flower (tetraploid) 1	2.966
	CNS0095614	Golden flower (tetraploid) 2	2.997
	CNS0095615	Golden flower (tetraploid) 3	2.077
CRA001975	CRR073297	Stem 1	2.198
	CRR073298	Stem 2	2.216
	CRR073299	Stem 3	1.410
	CRR073300	Leaf 1	3.189
	CRR073301	Leaf 2	3.385
	CRR073302	Leaf 3	3.355
	CRR073303	Juvenile bud 1	2.687
	CRR073304	Juvenile bud 2	2.625
	CRR073305	Juvenile bud 3	4.206
	CRR073306	Third green 1	3.918
	CRR073307	Third green 2	1.810
	CRR073308	Third green 3	1.426
	CRR073309	Second white 1	7.453
	CRR073310	Second white 2	4.679
	CRR073311	Second white 3	4.017
	CRR073312	Silver flowering 1	4.670
	CRR073313	Silver flowering 2	4.170
	CRR073314	Silver flowering 3	2.450
	CRR073315	Gold flowering 1	9.919
	CRR073316	Gold flowering 2	7.352
	CRR073317	Gold flowering 3	6.550
	CRR073318	Tawny withering 1	4.005
	CRR073319	Tawny withering 2	3.200
	CRR073320	Tawny withering 3	5.246