Gene detail

Detail information of GWHGAAZE002055

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP13112.1	1.28167E-22	unnamed protein product [Coffea canephora]
trEMBL	tr\|A0A068UXT4\|A0A068UXT4_COFCA	5E-23	Coffea canephora DH200=94 genomic scaffold, scaffold_73 {ECO:0000313\|EMBL:CDP13112.1}
TAIR10	AT1G05055.1	2E-17	general transcription factor II H2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	68215433	68215757	-
GWHAAZE00000001	mRNA	68215433	68215757	-
GWHAAZE00000001	exon	68215433	68215609	-
GWHAAZE00000001	exon	68215752	68215757	-
GWHAAZE00000001	CDS	68215752	68215757	-
GWHAAZE00000001	CDS	68215433	68215609	-

Transcript Sequence
>GWHTAAZE002059 ATGGTGCTGTTTTTATCGGGTTTAAAAAATGCAGGAAACATGCCAGGGCCTTGTGTTGCCTGCCCGAAATGCAAACAACATTTTTGCCTCGAGTGCGACATTTATATCCACGAGAGTTTGCACAATTGCCCCGGTTGTGAGAGCTTCAGGCAACCCAAGTCTGTCACTGCTACTCAAGAATGA

Network for GWHGAAZE002055

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF07975.13	C1_4	16	48	1.00E-17
PF00069.26	Pkinase	16	300	8.90E-61

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	STE_STE20-YSK

KEGG pathway

KO	Enzyme	pathway	mapID
K03142	TFIIH2, GTF2H2, SSL1	Basal transcription factors	map03022
K03142	TFIIH2, GTF2H2, SSL1	Nucleotide excision repair	map03420

Gene Ontology

GO term	Ontology	Name
GO:0006289	biological_process	nucleotide-excision repair
GO:0006351	biological_process	transcription, DNA-templated
GO:0006281	biological_process	DNA repair
GO:0006468	biological_process	protein phosphorylation
GO:0000439	cellular_component	transcription factor TFIIH core complex
GO:0008270	molecular_function	zinc ion binding
GO:0003676	molecular_function	nucleic acid binding
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	22.883
	SRR3591706	second leaf	9.083
	SRR3591707	mature leaf	13.399
	SRR3591708	Shoot apex	21.149
	SRR3591709	Stem	28.755
	SRR3591710	White floral bud	22.739
	SRR3591711	White flower	26.383
	SRR3591712	Green floral bud	28.354
	SRR3591713	Yellow flower	21.145
SRP173429	SRR8316895	Juvenile bud stage	22.092
	SRR8316896	Juvenile bud stage	22.690
	SRR8316897	Juvenile bud stage	7.382
	SRR8316894	Third green stage	9.648
	SRR8316900	Third green stage	33.416
	SRR8316901	Third green stage	32.730
	SRR8316898	Complete white stage	9.576
	SRR8316899	Complete white stage	31.500
	SRR8316903	Complete white stage	15.322
	SRR8316902	Silver flowering stage	13.889
	SRR8316904	Silver flowering stage	13.849
	SRR8316905	Silver flowering stage	6.648
	SRR8316906	Gold flowering stage	25.878
	SRR8316907	Gold flowering stage	29.279
	SRR8316908	Gold flowering stage	27.151
SRP132670	SRR6706286	Control	27.629
	SRR6706287	Light intensity 50%	25.949
	SRR6706288	Light intensity 20%	27.111
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	47.686
	CNS0095593	Slightly white alabastrum(diploid) 2	36.499
	CNS0095594	Slightly white alabastrum(diploid) 3	33.700
	CNS0095595	Whole white alabastrum(diploid) 2	43.017
	CNS0095596	Whole white alabastrum(diploid) 3	35.277
	CNS0095597	Whole white alabastrum(diploid) 4	38.650
	CNS0095598	Silvery flower (diploied) 1	32.353
	CNS0095599	Silvery flower (diploied) 2	30.503
	CNS0095600	Silvery flower (diploied) 3	29.774
	CNS0095601	Golden flower (diploid) 1	26.756
	CNS0095602	Golden flower (diploid) 2	27.898
	CNS0095603	Golden flower (diploid) 3	23.877
	CNS0095604	Slightly white alabastrum(tetraploid) 1	18.117
	CNS0095605	Slightly white alabastrum(tetraploid) 2	28.115
	CNS0095606	Slightly white alabastrum(tetraploid) 3	25.989
	CNS0095607	Whole white alabastrum(tetraploid) 1	28.673
	CNS0095608	Whole white alabastrum(tetraploid) 2	21.407
	CNS0095609	Whole white alabastrum(tetraploid) 3	18.812
	CNS0095610	Silvery flower (diploied) 1	19.926
	CNS0095611	Silvery flower (diploied) 2	19.683
	CNS0095612	Silvery flower (diploied) 3	17.676
	CNS0095613	Golden flower (tetraploid) 1	19.619
	CNS0095614	Golden flower (tetraploid) 2	23.560
	CNS0095615	Golden flower (tetraploid) 3	23.199
CRA001975	CRR073297	Stem 1	21.793
	CRR073298	Stem 2	20.137
	CRR073299	Stem 3	15.522
	CRR073300	Leaf 1	22.121
	CRR073301	Leaf 2	25.913
	CRR073302	Leaf 3	15.734
	CRR073303	Juvenile bud 1	17.874
	CRR073304	Juvenile bud 2	15.196
	CRR073305	Juvenile bud 3	24.636
	CRR073306	Third green 1	8.714
	CRR073307	Third green 2	11.937
	CRR073308	Third green 3	8.781
	CRR073309	Second white 1	13.084
	CRR073310	Second white 2	6.007
	CRR073311	Second white 3	7.492
	CRR073312	Silver flowering 1	13.136
	CRR073313	Silver flowering 2	6.726
	CRR073314	Silver flowering 3	9.688
	CRR073315	Gold flowering 1	6.544
	CRR073316	Gold flowering 2	7.261
	CRR073317	Gold flowering 3	7.728
	CRR073318	Tawny withering 1	22.156
	CRR073319	Tawny withering 2	19.516
	CRR073320	Tawny withering 3	17.464