Gene detail

Detail information of GWHGAAZE002092

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010535057.1	6.9946E-149	PREDICTED: ras-related protein RABA1f [Tarenaya hassleriana]
COG	YP_008431664.1	6E-26	hypothetical protein N186_01315
Swissprot	tr\|Q9FJH0\|RAA1F_ARATH	8E-149	Ras-related protein RABA1f
trEMBL	tr\|F6H1Y9\|F6H1Y9_VITVI	1E-148	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB46285.1}
TAIR10	AT5G60860.1	5E-110	RAB GTPase homolog A1F

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	69114557	69119689	+
GWHAAZE00000001	mRNA	69114557	69119689	+
GWHAAZE00000001	exon	69114557	69114777	+
GWHAAZE00000001	exon	69119257	69119689	+
GWHAAZE00000001	CDS	69114557	69114777	+
GWHAAZE00000001	CDS	69119257	69119689	+

Transcript Sequence
>GWHTAAZE002096 ATGGCGGCGTATAGAGCCGACGACGATTACGACTACTTATTCAAGGTGGTTCTGATCGGAGATTCCGGTGTCGGAAAATCCAATCTTCTCTCTAGATTCACCAAAAACGAGTTCAGCCTCGAGTCCAAATCCACAATCGGCGTTGAATTCGCCACTCGTAGCATTCGTGTCGATGATAAAGTCGTCAAGGCTCAGATTTGGGATACCGCTGGCCAGGAAAGATACCGAGCAATCACAAGCGCGTACTACCGAGGAGCAGTAGGTGCATTACTCGTCTACGATGTAACTCGACACGTCACCTTTGATAATGTAGAGAGATGGCTAAAGGAGCTTCGTGACCATACAGATGCCCACATTGTGATCATGCTTGTTGGTAACAAGGCCGATTTGCGTCACTTGCGTGCAGTTTCCATCGAAGATGCCAAGGCATTTGCAGAGAAAGAAAACACTTTCTTCATGGAAACGTCTGCCCTTGAGTCTTTAAACGTTGAAAACGCTTTCACCGAAGTGCTTTCTCAGATTTATCGCGTTGTCAGTAAGAAAGCTCTAGATATCGGGGACGATCCGATGGCCTTGCCTAAGGGAGAGACCATTAATGTTGGCGGCAAGGACGATGTATCGGCTATTAAAAAAGATGGGTGCTGCTCTTCTTAG

Network for GWHGAAZE002092

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00071.23	Ras	15	175	4.50E-62
PF00270.30	DEAD	82	226	2.30E-06

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K14442	DHX36, RHAU	RNA degradation	map03018

Gene Ontology

GO term	Ontology	Name
GO:0005525	molecular_function	GTP binding
GO:0003924	molecular_function	GTPase activity
GO:0003676	molecular_function	nucleic acid binding
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	19.999
	SRR3591706	second leaf	3.796
	SRR3591707	mature leaf	2.158
	SRR3591708	Shoot apex	18.315
	SRR3591709	Stem	13.938
	SRR3591710	White floral bud	13.956
	SRR3591711	White flower	10.095
	SRR3591712	Green floral bud	15.999
	SRR3591713	Yellow flower	11.085
SRP173429	SRR8316895	Juvenile bud stage	10.790
	SRR8316896	Juvenile bud stage	21.384
	SRR8316897	Juvenile bud stage	9.482
	SRR8316894	Third green stage	4.806
	SRR8316900	Third green stage	18.194
	SRR8316901	Third green stage	14.158
	SRR8316898	Complete white stage	3.743
	SRR8316899	Complete white stage	11.800
	SRR8316903	Complete white stage	5.672
	SRR8316902	Silver flowering stage	1.401
	SRR8316904	Silver flowering stage	1.871
	SRR8316905	Silver flowering stage	1.021
	SRR8316906	Gold flowering stage	6.933
	SRR8316907	Gold flowering stage	4.246
	SRR8316908	Gold flowering stage	6.587
SRP132670	SRR6706286	Control	13.365
	SRR6706287	Light intensity 50%	12.950
	SRR6706288	Light intensity 20%	13.535
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	15.885
	CNS0095593	Slightly white alabastrum(diploid) 2	14.563
	CNS0095594	Slightly white alabastrum(diploid) 3	16.149
	CNS0095595	Whole white alabastrum(diploid) 2	15.172
	CNS0095596	Whole white alabastrum(diploid) 3	22.632
	CNS0095597	Whole white alabastrum(diploid) 4	16.449
	CNS0095598	Silvery flower (diploied) 1	1.653
	CNS0095599	Silvery flower (diploied) 2	8.522
	CNS0095600	Silvery flower (diploied) 3	6.793
	CNS0095601	Golden flower (diploid) 1	4.312
	CNS0095602	Golden flower (diploid) 2	6.912
	CNS0095603	Golden flower (diploid) 3	8.307
	CNS0095604	Slightly white alabastrum(tetraploid) 1	13.072
	CNS0095605	Slightly white alabastrum(tetraploid) 2	14.929
	CNS0095606	Slightly white alabastrum(tetraploid) 3	7.350
	CNS0095607	Whole white alabastrum(tetraploid) 1	22.109
	CNS0095608	Whole white alabastrum(tetraploid) 2	20.512
	CNS0095609	Whole white alabastrum(tetraploid) 3	14.687
	CNS0095610	Silvery flower (diploied) 1	4.537
	CNS0095611	Silvery flower (diploied) 2	4.566
	CNS0095612	Silvery flower (diploied) 3	6.410
	CNS0095613	Golden flower (tetraploid) 1	3.657
	CNS0095614	Golden flower (tetraploid) 2	6.175
	CNS0095615	Golden flower (tetraploid) 3	7.505
CRA001975	CRR073297	Stem 1	14.825
	CRR073298	Stem 2	15.226
	CRR073299	Stem 3	21.203
	CRR073300	Leaf 1	14.605
	CRR073301	Leaf 2	13.576
	CRR073302	Leaf 3	19.504
	CRR073303	Juvenile bud 1	16.137
	CRR073304	Juvenile bud 2	18.158
	CRR073305	Juvenile bud 3	8.313
	CRR073306	Third green 1	13.102
	CRR073307	Third green 2	10.890
	CRR073308	Third green 3	10.805
	CRR073309	Second white 1	9.571
	CRR073310	Second white 2	7.182
	CRR073311	Second white 3	1.784
	CRR073312	Silver flowering 1	6.721
	CRR073313	Silver flowering 2	9.640
	CRR073314	Silver flowering 3	7.409
	CRR073315	Gold flowering 1	4.859
	CRR073316	Gold flowering 2	3.333
	CRR073317	Gold flowering 3	6.673
	CRR073318	Tawny withering 1	38.912
	CRR073319	Tawny withering 2	25.545
	CRR073320	Tawny withering 3	32.231