Gene detail

Detail information of GWHGAAZE002455

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010270154.1	1.73375E-92	PREDICTED: N-acetyltransferase 9-like protein isoform X2 [Nelumbo nucifera]
COG	YP_004786486.1	0.000007	N-acetyltransferase GCN5
trEMBL	tr\|A0A068U8I3\|A0A068U8I3_COFCA	3E-91	Coffea canephora DH200=94 genomic scaffold, scaffold_13 {ECO:0000313\|EMBL:CDP04612.1}
TAIR10	AT2G04845.2	1E-67	Acyl-CoA N-acyltransferases (NAT) superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	79104179	79106901	-
GWHAAZE00000001	mRNA	79104179	79106901	-
GWHAAZE00000001	exon	79104179	79104241	-
GWHAAZE00000001	exon	79104434	79104740	-
GWHAAZE00000001	exon	79104975	79105062	-
GWHAAZE00000001	exon	79106529	79106600	-
GWHAAZE00000001	exon	79106727	79106901	-
GWHAAZE00000001	CDS	79106727	79106901	-
GWHAAZE00000001	CDS	79106529	79106600	-
GWHAAZE00000001	CDS	79104975	79105062	-
GWHAAZE00000001	CDS	79104434	79104740	-
GWHAAZE00000001	CDS	79104179	79104241	-

Transcript Sequence
>GWHTAAZE002459 ATGAAGGTGAGCCTAGAAAGCGAGAAGGTAATACTTGTACCTTACATGAAAGAACACGTCCCAAAGTACCACCAATGGATGCAAGACCCTGACCTACTCCAAGCCACTGGTTCCGAACCTCTAACCCTTGACCAAGAGTACCAGATGCACCTCTCCTGGACCTTAGACCCCCTCAAGCAGACTTTTATAGTTTTGGATAAGGACTTGATTGTTGGCGAATTCATCCATGGAGATCCCCATGTTGAAGCCATGGTTGGTGATGTCAATATTTACATGAATGACTTGGACGATTCGCAAATGGCAGAGATCGAAATAATGATAGCCGAACCCAAAAGTCGTGGCAAAGGACTTGGGAAGAAAGCAGTTCTGATGATGATGAATTTTGCAGTTGAGAATTTCGGCATTCACAGCTTCCGTGTTAAAATCGGAGAGTCAAATGAAGCCTCTCTTAATCTCTTCCGAAAATTGGTTCTCTCTCTCTCTCTCTCACGCACACACATTTCAAAGCAGTGTTCTAAAAATTGGCCTAGGTAGTGTCTTGTTGTCTCACAAGGCCTCTAATTGGTGAAATAATTGGGCAGATGCCTGGACCGCAATGGGCTGAAATGGGCTTTTCTTTTTCTTCCCTTTTTTGTTGAAAAAGGATTCAAGGAGTCTTCTTACAGCGAAATCTTCAAAGAGGTGAGCTTAGTTCAAGTGCACTAG

Network for GWHGAAZE002455

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13302.8	Acetyltransf_3	10	156	1.50E-22

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	GNAT

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0008080	molecular_function	N-acetyltransferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	21.985
	SRR3591706	second leaf	7.637
	SRR3591707	mature leaf	13.493
	SRR3591708	Shoot apex	13.600
	SRR3591709	Stem	42.130
	SRR3591710	White floral bud	18.353
	SRR3591711	White flower	26.722
	SRR3591712	Green floral bud	16.063
	SRR3591713	Yellow flower	30.584
SRP173429	SRR8316895	Juvenile bud stage	12.630
	SRR8316896	Juvenile bud stage	13.179
	SRR8316897	Juvenile bud stage	8.380
	SRR8316894	Third green stage	6.173
	SRR8316900	Third green stage	18.487
	SRR8316901	Third green stage	18.952
	SRR8316898	Complete white stage	10.158
	SRR8316899	Complete white stage	28.740
	SRR8316903	Complete white stage	12.356
	SRR8316902	Silver flowering stage	13.586
	SRR8316904	Silver flowering stage	15.290
	SRR8316905	Silver flowering stage	10.041
	SRR8316906	Gold flowering stage	33.898
	SRR8316907	Gold flowering stage	29.084
	SRR8316908	Gold flowering stage	33.053
SRP132670	SRR6706286	Control	14.976
	SRR6706287	Light intensity 50%	17.569
	SRR6706288	Light intensity 20%	17.458
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	14.795
	CNS0095593	Slightly white alabastrum(diploid) 2	15.951
	CNS0095594	Slightly white alabastrum(diploid) 3	13.467
	CNS0095595	Whole white alabastrum(diploid) 2	12.736
	CNS0095596	Whole white alabastrum(diploid) 3	12.168
	CNS0095597	Whole white alabastrum(diploid) 4	13.183
	CNS0095598	Silvery flower (diploied) 1	17.818
	CNS0095599	Silvery flower (diploied) 2	22.330
	CNS0095600	Silvery flower (diploied) 3	24.200
	CNS0095601	Golden flower (diploid) 1	19.712
	CNS0095602	Golden flower (diploid) 2	22.008
	CNS0095603	Golden flower (diploid) 3	21.952
	CNS0095604	Slightly white alabastrum(tetraploid) 1	11.595
	CNS0095605	Slightly white alabastrum(tetraploid) 2	11.194
	CNS0095606	Slightly white alabastrum(tetraploid) 3	15.693
	CNS0095607	Whole white alabastrum(tetraploid) 1	7.714
	CNS0095608	Whole white alabastrum(tetraploid) 2	7.889
	CNS0095609	Whole white alabastrum(tetraploid) 3	14.378
	CNS0095610	Silvery flower (diploied) 1	22.827
	CNS0095611	Silvery flower (diploied) 2	22.719
	CNS0095612	Silvery flower (diploied) 3	15.649
	CNS0095613	Golden flower (tetraploid) 1	18.851
	CNS0095614	Golden flower (tetraploid) 2	22.803
	CNS0095615	Golden flower (tetraploid) 3	21.816
CRA001975	CRR073297	Stem 1	15.973
	CRR073298	Stem 2	11.014
	CRR073299	Stem 3	9.533
	CRR073300	Leaf 1	17.181
	CRR073301	Leaf 2	18.502
	CRR073302	Leaf 3	12.258
	CRR073303	Juvenile bud 1	15.388
	CRR073304	Juvenile bud 2	11.162
	CRR073305	Juvenile bud 3	12.576
	CRR073306	Third green 1	2.157
	CRR073307	Third green 2	3.609
	CRR073308	Third green 3	2.877
	CRR073309	Second white 1	7.775
	CRR073310	Second white 2	11.025
	CRR073311	Second white 3	8.982
	CRR073312	Silver flowering 1	3.520
	CRR073313	Silver flowering 2	6.549
	CRR073314	Silver flowering 3	4.569
	CRR073315	Gold flowering 1	15.966
	CRR073316	Gold flowering 2	17.254
	CRR073317	Gold flowering 3	8.676
	CRR073318	Tawny withering 1	13.108
	CRR073319	Tawny withering 2	15.560
	CRR073320	Tawny withering 3	16.021