Gene detail

Detail information of GWHGAAZE002737

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP05856.1	9.63932E-54	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q5CCK4\|VAL2_ARATH	2E-38	B3 domain-containing transcription repressor VAL2
trEMBL	tr\|A0A068UBK4\|A0A068UBK4_COFCA	4E-54	Coffea canephora DH200=94 genomic scaffold, scaffold_19 {ECO:0000313\|EMBL:CDP05856.1}
TAIR10	AT4G32010.1	7E-34	HSI2-like 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	85269410	85271109	-
GWHAAZE00000001	mRNA	85269410	85271109	-
GWHAAZE00000001	exon	85271008	85271109	-
GWHAAZE00000001	exon	85270515	85270689	-
GWHAAZE00000001	exon	85269509	85269588	-
GWHAAZE00000001	exon	85269410	85269421	-
GWHAAZE00000001	CDS	85271008	85271109	-
GWHAAZE00000001	CDS	85270515	85270689	-
GWHAAZE00000001	CDS	85269509	85269588	-
GWHAAZE00000001	CDS	85269410	85269421	-

Transcript Sequence
>GWHTAAZE002741 AGCCCAAAATGTATCGTCATTCCTTTATTTGAACAGTTATTGTCTGCAACTGATGCTGACCTCGGACTGGCCCGTCTGGTGATACCAAAAAAGTGCGCAGAGACTTTTTTCCCAGACATTTCTGAGCCGCAGGGCTTACCCATCAAAATCCGGGATACAGAAGGCAAAGAATGGGAGTTTCGCTACCGTTCTTGGCCAAATGGTGACAGTAAGATGTACGTTTTAGAAGGGCTCAGAGATTATATGATCTCAATGAAATGGCAAGCGGGTGATGTAGTGACATTTTACCGATTGGATCCAGAGCGGAAGTTGGTCATGGGATTAAGAAAGACATCTGCCAAACCACAACTGCATGAGGATGTTTCATGA

Network for GWHGAAZE002737

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02362.22	B3	20	110	5.10E-14

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	B3

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	14.790
	SRR3591706	second leaf	5.292
	SRR3591707	mature leaf	3.980
	SRR3591708	Shoot apex	13.122
	SRR3591709	Stem	16.836
	SRR3591710	White floral bud	4.838
	SRR3591711	White flower	7.838
	SRR3591712	Green floral bud	12.489
	SRR3591713	Yellow flower	4.182
SRP173429	SRR8316895	Juvenile bud stage	7.746
	SRR8316896	Juvenile bud stage	9.459
	SRR8316897	Juvenile bud stage	6.138
	SRR8316894	Third green stage	4.718
	SRR8316900	Third green stage	14.149
	SRR8316901	Third green stage	12.904
	SRR8316898	Complete white stage	2.677
	SRR8316899	Complete white stage	21.927
	SRR8316903	Complete white stage	2.201
	SRR8316902	Silver flowering stage	3.606
	SRR8316904	Silver flowering stage	3.320
	SRR8316905	Silver flowering stage	0.930
	SRR8316906	Gold flowering stage	4.333
	SRR8316907	Gold flowering stage	3.872
	SRR8316908	Gold flowering stage	4.750
SRP132670	SRR6706286	Control	13.094
	SRR6706287	Light intensity 50%	12.765
	SRR6706288	Light intensity 20%	14.197
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	11.275
	CNS0095593	Slightly white alabastrum(diploid) 2	12.806
	CNS0095594	Slightly white alabastrum(diploid) 3	12.427
	CNS0095595	Whole white alabastrum(diploid) 2	10.790
	CNS0095596	Whole white alabastrum(diploid) 3	9.115
	CNS0095597	Whole white alabastrum(diploid) 4	7.005
	CNS0095598	Silvery flower (diploied) 1	9.586
	CNS0095599	Silvery flower (diploied) 2	9.620
	CNS0095600	Silvery flower (diploied) 3	8.230
	CNS0095601	Golden flower (diploid) 1	10.912
	CNS0095602	Golden flower (diploid) 2	7.995
	CNS0095603	Golden flower (diploid) 3	8.040
	CNS0095604	Slightly white alabastrum(tetraploid) 1	10.861
	CNS0095605	Slightly white alabastrum(tetraploid) 2	6.718
	CNS0095606	Slightly white alabastrum(tetraploid) 3	18.586
	CNS0095607	Whole white alabastrum(tetraploid) 1	5.539
	CNS0095608	Whole white alabastrum(tetraploid) 2	6.313
	CNS0095609	Whole white alabastrum(tetraploid) 3	11.985
	CNS0095610	Silvery flower (diploied) 1	10.017
	CNS0095611	Silvery flower (diploied) 2	7.731
	CNS0095612	Silvery flower (diploied) 3	3.082
	CNS0095613	Golden flower (tetraploid) 1	2.935
	CNS0095614	Golden flower (tetraploid) 2	6.674
	CNS0095615	Golden flower (tetraploid) 3	1.866
CRA001975	CRR073297	Stem 1	7.437
	CRR073298	Stem 2	6.976
	CRR073299	Stem 3	10.743
	CRR073300	Leaf 1	12.748
	CRR073301	Leaf 2	13.413
	CRR073302	Leaf 3	10.900
	CRR073303	Juvenile bud 1	12.071
	CRR073304	Juvenile bud 2	8.452
	CRR073305	Juvenile bud 3	15.740
	CRR073306	Third green 1	1.496
	CRR073307	Third green 2	1.216
	CRR073308	Third green 3	0.262
	CRR073309	Second white 1	1.591
	CRR073310	Second white 2	3.657
	CRR073311	Second white 3	0.612
	CRR073312	Silver flowering 1	0.297
	CRR073313	Silver flowering 2	0.910
	CRR073314	Silver flowering 3	0.720
	CRR073315	Gold flowering 1	4.019
	CRR073316	Gold flowering 2	6.125
	CRR073317	Gold flowering 3	9.754
	CRR073318	Tawny withering 1	22.734
	CRR073319	Tawny withering 2	16.770
	CRR073320	Tawny withering 3	18.865