Gene detail

Detail information of GWHGAAZE002757

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CAN64973.1	7.0811E-39	hypothetical protein VITISV_025930 [Vitis vinifera]
COG	YP_004696643.1	0.00000003	serine/threonine protein kinase
Swissprot	tr\|Q9ZR08\|Y4230_ARATH	3E-31	G-type lectin S-receptor-like serine/threonine-protein kinase At4g03230 (Precursor)
trEMBL	tr\|A5AWE1\|A5AWE1_VITVI	3E-39	Putative uncharacterized protein {ECO:0000313\|EMBL:CAN64973.1}
TAIR10	AT4G03230.1	4E-28	S-locus lectin protein kinase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	85709285	85710104	+
GWHAAZE00000001	mRNA	85709285	85710104	+
GWHAAZE00000001	exon	85709285	85709470	+
GWHAAZE00000001	exon	85709829	85710104	+
GWHAAZE00000001	CDS	85709285	85709470	+
GWHAAZE00000001	CDS	85709829	85710104	+

Transcript Sequence
>GWHTAAZE002761 ATGAAATTAATTGAAATCTACCTGCAAAGAGAGTGTATTCAACTAATATCTGATTTTAAATTTTCAGAAGCAAGCAAGGAAGACCTAGAGTTGCCACTTTTTAATCTGGCTACTATGATAAATGCCAGTAGTAACTTCTCTTCCACAAATATGATCACAACGGGTGGTTTTGGGTCTGTTTACAAGACCAACATAGTATTGATCTGGTACAAATGTCATACAGATCAAAACAATAAACTTTTGCTGATGTGGCACAACCGCTTTGAAATTGCTTTGGGTATTGCAAAGGGCCTTATATACCTTCATCGCAACTCAAGACTAAGAATTATTCACCAGGATCTCAAAGCAAGCAATGTTTTACTTGATAGTGAGCTAAACTCCAAAATTTCGGACTTCAGTATTGCAAGAATATTTGGAGGAGAGCAAATTGAAGCGAAAACAAAGAGCGTAATTGGAACATAG

Network for GWHGAAZE002757

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	62	151	3.50E-12

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_DLSV

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.222
	SRR3591706	second leaf	0.210
	SRR3591707	mature leaf	0.386
	SRR3591708	Shoot apex	0.678
	SRR3591709	Stem	1.020
	SRR3591710	White floral bud	0.728
	SRR3591711	White flower	0.504
	SRR3591712	Green floral bud	0.591
	SRR3591713	Yellow flower	0.694
SRP173429	SRR8316895	Juvenile bud stage	0.254
	SRR8316896	Juvenile bud stage	0.081
	SRR8316897	Juvenile bud stage	0.232
	SRR8316894	Third green stage	0.090
	SRR8316900	Third green stage	0.388
	SRR8316901	Third green stage	0.121
	SRR8316898	Complete white stage	0.186
	SRR8316899	Complete white stage	0.865
	SRR8316903	Complete white stage	0.035
	SRR8316902	Silver flowering stage	0.213
	SRR8316904	Silver flowering stage	0.074
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.170
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.274
SRP132670	SRR6706286	Control	0.035
	SRR6706287	Light intensity 50%	0.078
	SRR6706288	Light intensity 20%	0.058
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.323
	CNS0095593	Slightly white alabastrum(diploid) 2	0.288
	CNS0095594	Slightly white alabastrum(diploid) 3	0.445
	CNS0095595	Whole white alabastrum(diploid) 2	0.848
	CNS0095596	Whole white alabastrum(diploid) 3	0.120
	CNS0095597	Whole white alabastrum(diploid) 4	0.854
	CNS0095598	Silvery flower (diploied) 1	1.010
	CNS0095599	Silvery flower (diploied) 2	0.724
	CNS0095600	Silvery flower (diploied) 3	0.410
	CNS0095601	Golden flower (diploid) 1	0.901
	CNS0095602	Golden flower (diploid) 2	0.806
	CNS0095603	Golden flower (diploid) 3	0.466
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.249
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.023
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.299
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.229
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.459
	CNS0095610	Silvery flower (diploied) 1	0.016
	CNS0095611	Silvery flower (diploied) 2	0.333
	CNS0095612	Silvery flower (diploied) 3	0.211
	CNS0095613	Golden flower (tetraploid) 1	0.082
	CNS0095614	Golden flower (tetraploid) 2	0.523
	CNS0095615	Golden flower (tetraploid) 3	0.094
CRA001975	CRR073297	Stem 1	0.076
	CRR073298	Stem 2	0.122
	CRR073299	Stem 3	0.071
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.066
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.378
	CRR073319	Tawny withering 2	0.279
	CRR073320	Tawny withering 3	0.000