Gene detail

Detail information of GWHGAAZE002950

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010644585.1	2.7552E-52	PREDICTED: poly(A)-specific ribonuclease PARN [Vitis vinifera]
Swissprot	tr\|Q9LG26\|PARN_ARATH	5E-42	Poly(A)-specific ribonuclease PARN
trEMBL	tr\|F6I563\|F6I563_VITVI	1E-52	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB62018.1}
TAIR10	AT1G55870.1	2E-35	Polynucleotidyl transferase, ribonuclease H-like superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	89092303	89092677	-
GWHAAZE00000001	mRNA	89092303	89092677	-
GWHAAZE00000001	exon	89092303	89092677	-
GWHAAZE00000001	CDS	89092303	89092677	-

Transcript Sequence
>GWHTAAZE002954 ATGAAGCAACTTTGGAAGGTTAGGGTACTTTCCGAAACCCTAACTCTATCTTCTCACTCAACCTCCTCATTTATTCGCACCTTTTCTTCTTCATCATCATCATCAAGCTTCGCTCTTAAGAATGTTACAAAATCCAACTTCGAATCTGCTCTGTCCGCTCTCAGGCTCCACGTTCGAGACGCCGACTTCGTCTCCATCGACCTGGAGATGACCGGAGTCACCAGCGCTCCGTGGAGAGAGTCGTTCGAGTTCGACCGATTCGACATTCGTTATCTTAAAGTCAAAGATTCTGCCCAGAAGTTCGCCGTTGTTCAGTTCGGCGTTTGTCCTTTCCGCTGGGATCACTCCAAGCAGTCCTTTATTGCTTATCCGTAA

Network for GWHGAAZE002950

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04857.21	CAF1	42	119	2.50E-22

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01148	PARN, PNLDC1	RNA degradation	map03018

Gene Ontology

GO term	Ontology	Name
GO:0003676	molecular_function	nucleic acid binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	12.791
	SRR3591706	second leaf	5.176
	SRR3591707	mature leaf	5.319
	SRR3591708	Shoot apex	12.759
	SRR3591709	Stem	15.096
	SRR3591710	White floral bud	12.316
	SRR3591711	White flower	16.608
	SRR3591712	Green floral bud	17.252
	SRR3591713	Yellow flower	5.514
SRP173429	SRR8316895	Juvenile bud stage	13.425
	SRR8316896	Juvenile bud stage	13.289
	SRR8316897	Juvenile bud stage	8.972
	SRR8316894	Third green stage	7.163
	SRR8316900	Third green stage	18.886
	SRR8316901	Third green stage	22.998
	SRR8316898	Complete white stage	11.476
	SRR8316899	Complete white stage	32.077
	SRR8316903	Complete white stage	20.645
	SRR8316902	Silver flowering stage	6.527
	SRR8316904	Silver flowering stage	13.714
	SRR8316905	Silver flowering stage	8.507
	SRR8316906	Gold flowering stage	18.518
	SRR8316907	Gold flowering stage	21.764
	SRR8316908	Gold flowering stage	20.366
SRP132670	SRR6706286	Control	77.215
	SRR6706287	Light intensity 50%	79.565
	SRR6706288	Light intensity 20%	77.771
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	9.551
	CNS0095593	Slightly white alabastrum(diploid) 2	8.077
	CNS0095594	Slightly white alabastrum(diploid) 3	6.202
	CNS0095595	Whole white alabastrum(diploid) 2	6.931
	CNS0095596	Whole white alabastrum(diploid) 3	7.967
	CNS0095597	Whole white alabastrum(diploid) 4	7.840
	CNS0095598	Silvery flower (diploied) 1	21.062
	CNS0095599	Silvery flower (diploied) 2	14.613
	CNS0095600	Silvery flower (diploied) 3	29.444
	CNS0095601	Golden flower (diploid) 1	7.529
	CNS0095602	Golden flower (diploid) 2	28.637
	CNS0095603	Golden flower (diploid) 3	27.225
	CNS0095604	Slightly white alabastrum(tetraploid) 1	11.601
	CNS0095605	Slightly white alabastrum(tetraploid) 2	6.754
	CNS0095606	Slightly white alabastrum(tetraploid) 3	25.919
	CNS0095607	Whole white alabastrum(tetraploid) 1	4.708
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.719
	CNS0095609	Whole white alabastrum(tetraploid) 3	18.751
	CNS0095610	Silvery flower (diploied) 1	18.618
	CNS0095611	Silvery flower (diploied) 2	23.670
	CNS0095612	Silvery flower (diploied) 3	14.274
	CNS0095613	Golden flower (tetraploid) 1	5.656
	CNS0095614	Golden flower (tetraploid) 2	14.261
	CNS0095615	Golden flower (tetraploid) 3	11.804
CRA001975	CRR073297	Stem 1	35.572
	CRR073298	Stem 2	30.160
	CRR073299	Stem 3	19.172
	CRR073300	Leaf 1	44.577
	CRR073301	Leaf 2	30.728
	CRR073302	Leaf 3	25.930
	CRR073303	Juvenile bud 1	14.466
	CRR073304	Juvenile bud 2	14.305
	CRR073305	Juvenile bud 3	20.478
	CRR073306	Third green 1	5.884
	CRR073307	Third green 2	4.931
	CRR073308	Third green 3	8.005
	CRR073309	Second white 1	2.437
	CRR073310	Second white 2	7.048
	CRR073311	Second white 3	7.035
	CRR073312	Silver flowering 1	4.721
	CRR073313	Silver flowering 2	2.189
	CRR073314	Silver flowering 3	1.507
	CRR073315	Gold flowering 1	12.836
	CRR073316	Gold flowering 2	17.371
	CRR073317	Gold flowering 3	7.965
	CRR073318	Tawny withering 1	10.240
	CRR073319	Tawny withering 2	6.671
	CRR073320	Tawny withering 3	11.777