Gene detail

Detail information of GWHGAAZE003505

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ABO48363.1	7.65021E-85	C-repeat binding facor 1 [Populus trichocarpa]
Swissprot	tr\|Q9FJ93\|DRE1D_ARATH	4E-69	Dehydration-responsive element-binding protein 1D
trEMBL	tr\|A9PL43\|A9PL43_POPTR	3E-85	C-repeat binding facor 1 {ECO:0000313\|EMBL:ABO48363.1}
TAIR10	AT5G51990.1	9E-48	C-repeat-binding factor 4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	99147733	99148293	-
GWHAAZE00000001	mRNA	99147733	99148293	-
GWHAAZE00000001	exon	99147733	99148293	-
GWHAAZE00000001	CDS	99147733	99148293	-

Transcript Sequence
>GWHTAAZE003511 ATGCTGGCATCGAGCCACCCGAAAAAGCGTGCGGGTCGAATAAAATTCATGGAGACCAGGCACCCCGTGTACAGGGGGGTGAGGAAGAGGAACTCCGGCAAGTGGGTCTGCGAGGTGAGACAACCAAACAAGAAGTCTAGAATATGGCTCGGGACATACCCTTCTGCTGACATGGCCGCTAGAGCTCATGATGTGGCGGCTATTGCGCTTAGGGGACGGTCCGCTTGCCTCAATTTCGCCGACTCCACGTGGCGGCTTCCCATTCCGGCGTCCAGCGATGTCAAGGATATTCAAAGGGCGGCGGCTGAGGCAGCTGAAATTTTCCGGTCGCCGGAATCTGACGTGGTCTTCGAAAATGACTTGGTTGAGGAAATTGCCAGGTCATTGTTGCCGGAGAATGGATTTTACACGGATGACGAGTCGGTTTTTGGCTTGGAGGAGGTACTTGCGAATATGGCAGAAGGGTTGATGCTACCTTCACCTCACTGCGGCGAAGATGGGTATGGAAAGGATGACATGGAAATTAGTGCTGACATGTTCTTGTGGAGTTACTCCCTTTGA

Network for GWHGAAZE003505

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	22	72	6.40E-14

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.165
	SRR3591706	second leaf	2.317
	SRR3591707	mature leaf	0.441
	SRR3591708	Shoot apex	2.337
	SRR3591709	Stem	0.916
	SRR3591710	White floral bud	11.426
	SRR3591711	White flower	7.030
	SRR3591712	Green floral bud	7.201
	SRR3591713	Yellow flower	3.473
SRP173429	SRR8316895	Juvenile bud stage	4.757
	SRR8316896	Juvenile bud stage	6.479
	SRR8316897	Juvenile bud stage	0.921
	SRR8316894	Third green stage	1.145
	SRR8316900	Third green stage	2.011
	SRR8316901	Third green stage	6.574
	SRR8316898	Complete white stage	0.667
	SRR8316899	Complete white stage	7.714
	SRR8316903	Complete white stage	0.978
	SRR8316902	Silver flowering stage	0.242
	SRR8316904	Silver flowering stage	0.096
	SRR8316905	Silver flowering stage	0.090
	SRR8316906	Gold flowering stage	0.124
	SRR8316907	Gold flowering stage	0.787
	SRR8316908	Gold flowering stage	0.394
SRP132670	SRR6706286	Control	0.094
	SRR6706287	Light intensity 50%	0.547
	SRR6706288	Light intensity 20%	0.665
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.105
	CNS0095593	Slightly white alabastrum(diploid) 2	5.149
	CNS0095594	Slightly white alabastrum(diploid) 3	9.070
	CNS0095595	Whole white alabastrum(diploid) 2	4.123
	CNS0095596	Whole white alabastrum(diploid) 3	0.973
	CNS0095597	Whole white alabastrum(diploid) 4	4.030
	CNS0095598	Silvery flower (diploied) 1	20.437
	CNS0095599	Silvery flower (diploied) 2	3.377
	CNS0095600	Silvery flower (diploied) 3	1.621
	CNS0095601	Golden flower (diploid) 1	0.935
	CNS0095602	Golden flower (diploid) 2	0.483
	CNS0095603	Golden flower (diploid) 3	0.932
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.139
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.953
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.674
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.505
	CNS0095610	Silvery flower (diploied) 1	0.108
	CNS0095611	Silvery flower (diploied) 2	0.000
	CNS0095612	Silvery flower (diploied) 3	10.524
	CNS0095613	Golden flower (tetraploid) 1	0.105
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.060
CRA001975	CRR073297	Stem 1	1.647
	CRR073298	Stem 2	2.525
	CRR073299	Stem 3	1.916
	CRR073300	Leaf 1	4.595
	CRR073301	Leaf 2	7.464
	CRR073302	Leaf 3	5.101
	CRR073303	Juvenile bud 1	1.695
	CRR073304	Juvenile bud 2	2.787
	CRR073305	Juvenile bud 3	9.138
	CRR073306	Third green 1	0.820
	CRR073307	Third green 2	3.793
	CRR073308	Third green 3	2.471
	CRR073309	Second white 1	1.664
	CRR073310	Second white 2	1.394
	CRR073311	Second white 3	1.657
	CRR073312	Silver flowering 1	9.393
	CRR073313	Silver flowering 2	3.714
	CRR073314	Silver flowering 3	1.688
	CRR073315	Gold flowering 1	1.852
	CRR073316	Gold flowering 2	1.169
	CRR073317	Gold flowering 3	0.336
	CRR073318	Tawny withering 1	0.267
	CRR073319	Tawny withering 2	1.738
	CRR073320	Tawny withering 3	0.219