Gene detail

Detail information of GWHGAAZE003707

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010251668.1	1.83582E-56	PREDICTED: homeobox-leucine zipper protein ATHB-12-like isoform X1 [Nelumbo nucifera]
Swissprot	tr\|Q9M276\|ATB12_ARATH	1E-38	Homeobox-leucine zipper protein ATHB-12
trEMBL	tr\|V7ARQ4\|V7ARQ4_PHAVU	2E-53	Uncharacterized protein {ECO:0000313\|EMBL:ESW07288.1}
TAIR10	AT3G61890.1	2E-32	homeobox 12

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	102584102	102584768	-
GWHAAZE00000001	mRNA	102584102	102584768	-
GWHAAZE00000001	exon	102584547	102584768	-
GWHAAZE00000001	exon	102584102	102584452	-
GWHAAZE00000001	CDS	102584547	102584768	-
GWHAAZE00000001	CDS	102584102	102584452	-

Transcript Sequence
>GWHTAAZE003713 ATGTTCAAGCTGGAGACAAAGCTCGAGCCGAGGAAGAAGCTGCACCTGGCTAGAGAGCTTGGGCTGCAACCACGCCAAGTAGCTATATGGTTTCAAAACAGAAGAGCCAGATGGAAATCAAAGCAAATTGAACAAGATTACAAACTACTCAAATCCAATTATGACAACCTAAGCTCAAGATTTGACTCCGTAAAGAAAGAAAAACAATCCTTGCTCATACAGTTACAGAAGCTAAGAGATCAGCTCAAAGGTGGGGGAAGCAAGGATGTGGAAGGTAATAGTACTGATGACAGTGTCTCGGAAAATGGAAAGAAAATTTGCGATTTCACGGAAAATCCAAATTGCTCAAGAGAAAGATTGGGCCGCGATGTGGTGGTGTATTCAGATGACGATGATAATTTAAGAAGCAGCAGGTACACTGCACAAGGAGAAGAAGAAACAGAACTTAGGAACTTTGGTGAGCAAGTAGATATGTCCTTAGTACCACCTGAGAGATGGTGCAATTTTGAGATGGGTGGAGTTTTCGATCACACATGCAGTGGCACTTTAAACTGGTGGGACTTTTCGACTTGA

Network for GWHGAAZE003707

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00046.30	Homeodomain	1	39	9.30E-12
PF02183.19	HALZ	41	82	4.70E-15

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	HB-HD-ZIP

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0043565	molecular_function	sequence-specific DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.661
	SRR3591706	second leaf	1.302
	SRR3591707	mature leaf	1.231
	SRR3591708	Shoot apex	0.275
	SRR3591709	Stem	16.509
	SRR3591710	White floral bud	5.528
	SRR3591711	White flower	54.870
	SRR3591712	Green floral bud	0.724
	SRR3591713	Yellow flower	119.102
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.184
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.274
	SRR8316901	Third green stage	0.220
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	1.108
	SRR8316903	Complete white stage	0.498
	SRR8316902	Silver flowering stage	0.954
	SRR8316904	Silver flowering stage	3.714
	SRR8316905	Silver flowering stage	0.756
	SRR8316906	Gold flowering stage	16.771
	SRR8316907	Gold flowering stage	39.996
	SRR8316908	Gold flowering stage	31.043
SRP132670	SRR6706286	Control	0.314
	SRR6706287	Light intensity 50%	0.450
	SRR6706288	Light intensity 20%	0.337
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.756
	CNS0095593	Slightly white alabastrum(diploid) 2	0.281
	CNS0095594	Slightly white alabastrum(diploid) 3	1.027
	CNS0095595	Whole white alabastrum(diploid) 2	0.102
	CNS0095596	Whole white alabastrum(diploid) 3	0.172
	CNS0095597	Whole white alabastrum(diploid) 4	0.193
	CNS0095598	Silvery flower (diploied) 1	18.159
	CNS0095599	Silvery flower (diploied) 2	7.561
	CNS0095600	Silvery flower (diploied) 3	32.424
	CNS0095601	Golden flower (diploid) 1	11.196
	CNS0095602	Golden flower (diploid) 2	56.922
	CNS0095603	Golden flower (diploid) 3	57.492
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.126
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.704
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.121
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.230
	CNS0095610	Silvery flower (diploied) 1	53.116
	CNS0095611	Silvery flower (diploied) 2	71.399
	CNS0095612	Silvery flower (diploied) 3	19.311
	CNS0095613	Golden flower (tetraploid) 1	50.361
	CNS0095614	Golden flower (tetraploid) 2	58.193
	CNS0095615	Golden flower (tetraploid) 3	31.206
CRA001975	CRR073297	Stem 1	0.039
	CRR073298	Stem 2	0.066
	CRR073299	Stem 3	0.147
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.079
	CRR073302	Leaf 3	0.066
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.063
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	1.660
	CRR073310	Second white 2	2.997
	CRR073311	Second white 3	3.306
	CRR073312	Silver flowering 1	9.259
	CRR073313	Silver flowering 2	12.341
	CRR073314	Silver flowering 3	20.327
	CRR073315	Gold flowering 1	1.955
	CRR073316	Gold flowering 2	2.296
	CRR073317	Gold flowering 3	1.132
	CRR073318	Tawny withering 1	14.441
	CRR073319	Tawny withering 2	8.472
	CRR073320	Tawny withering 3	19.248