Gene detail

Detail information of GWHGAAZE004072

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007028543.1	2.13402E-86	Tetratricopeptide repeat (TPR)-like superfamily protein [Theobroma cacao]
Swissprot	tr\|Q9M1J1\|FIS1A_ARATH	8E-73	Mitochondrial fission 1 protein A
trEMBL	tr\|A0A061EVC0\|A0A061EVC0_THECC	8E-87	Tetratricopeptide repeat (TPR)-like superfamily protein {ECO:0000313\|EMBL:EOY09045.1}
TAIR10	AT3G57090.1	3E-54	Tetratricopeptide repeat (TPR)-like superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	110547914	110552401	-
GWHAAZE00000001	mRNA	110547914	110552401	-
GWHAAZE00000001	exon	110547914	110547990	-
GWHAAZE00000001	exon	110548236	110548299	-
GWHAAZE00000001	exon	110548793	110548917	-
GWHAAZE00000001	exon	110550076	110550214	-
GWHAAZE00000001	exon	110552309	110552401	-
GWHAAZE00000001	CDS	110552309	110552401	-
GWHAAZE00000001	CDS	110550076	110550214	-
GWHAAZE00000001	CDS	110548793	110548917	-
GWHAAZE00000001	CDS	110548236	110548299	-
GWHAAZE00000001	CDS	110547914	110547990	-

Transcript Sequence
>GWHTAAZE004078 ATGGAGGCGAAGATCAACCAATTAATCGAATCGGTTTCCTCTTTCTTCAGCGCCGGAGATCAGATCCCATGGTGCGAACGCGACATCATCGTGGGGTGCGAGAAAGAAGTAGCAGAGGCTGCAAAAGGTGACTCGGAAGAAGTAAAAGCTGGAAGCATAATGCGATTATCGTGGGCTCTTGTTCATTCCAGACAACAAGATGATGTGCACCGTGGGATAGCTATGCTTGAAGCTTCGTTAGCCAAGAGAAGCAACAGTCCATTGCAAGAGAGGGAGAAACTTTATCTTCTTGCTGTTGGAAACTATAGAAGTGGTGAATTCTCAAAGAGCAGGAAGCTTTTGGAAAAATGTTTGGAGATTTCACCTGATTGGAGGCAGGCTTTGTCACTCAAGAATATGGTCGAAGAACGAATTACCAAAGATGGCGTCATTGGAATCGGCATTACTGCTACTACAGTTGGACTTATCGTCGGGGGACTTGCGGCAGCATTGGCCCGA

Network for GWHGAAZE004072

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF14852.7	Fis1_TPR_N	52	80	8.90E-10
PF14853.7	Fis1_TPR_C	91	143	1.00E-21

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K17969	FIS1, TTC11, MDV2	Mitophagy - animal	map04137
K17969	FIS1, TTC11, MDV2	Mitophagy - yeast	map04139

Gene Ontology

GO term	Ontology	Name
GO:0000266	biological_process	mitochondrial fission
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	9.987
	SRR3591706	second leaf	6.639
	SRR3591707	mature leaf	13.628
	SRR3591708	Shoot apex	9.222
	SRR3591709	Stem	13.321
	SRR3591710	White floral bud	79.919
	SRR3591711	White flower	18.385
	SRR3591712	Green floral bud	14.257
	SRR3591713	Yellow flower	23.931
SRP173429	SRR8316895	Juvenile bud stage	3.439
	SRR8316896	Juvenile bud stage	8.950
	SRR8316897	Juvenile bud stage	4.089
	SRR8316894	Third green stage	3.112
	SRR8316900	Third green stage	8.640
	SRR8316901	Third green stage	8.287
	SRR8316898	Complete white stage	3.164
	SRR8316899	Complete white stage	11.385
	SRR8316903	Complete white stage	4.458
	SRR8316902	Silver flowering stage	4.273
	SRR8316904	Silver flowering stage	4.418
	SRR8316905	Silver flowering stage	2.972
	SRR8316906	Gold flowering stage	13.166
	SRR8316907	Gold flowering stage	10.077
	SRR8316908	Gold flowering stage	10.413
SRP132670	SRR6706286	Control	11.362
	SRR6706287	Light intensity 50%	9.852
	SRR6706288	Light intensity 20%	9.713
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	5.158
	CNS0095593	Slightly white alabastrum(diploid) 2	3.282
	CNS0095594	Slightly white alabastrum(diploid) 3	10.190
	CNS0095595	Whole white alabastrum(diploid) 2	4.861
	CNS0095596	Whole white alabastrum(diploid) 3	4.149
	CNS0095597	Whole white alabastrum(diploid) 4	6.017
	CNS0095598	Silvery flower (diploied) 1	7.826
	CNS0095599	Silvery flower (diploied) 2	8.117
	CNS0095600	Silvery flower (diploied) 3	7.376
	CNS0095601	Golden flower (diploid) 1	10.420
	CNS0095602	Golden flower (diploid) 2	8.102
	CNS0095603	Golden flower (diploid) 3	8.162
	CNS0095604	Slightly white alabastrum(tetraploid) 1	6.929
	CNS0095605	Slightly white alabastrum(tetraploid) 2	7.324
	CNS0095606	Slightly white alabastrum(tetraploid) 3	11.374
	CNS0095607	Whole white alabastrum(tetraploid) 1	7.912
	CNS0095608	Whole white alabastrum(tetraploid) 2	4.856
	CNS0095609	Whole white alabastrum(tetraploid) 3	10.192
	CNS0095610	Silvery flower (diploied) 1	15.907
	CNS0095611	Silvery flower (diploied) 2	18.667
	CNS0095612	Silvery flower (diploied) 3	17.250
	CNS0095613	Golden flower (tetraploid) 1	10.302
	CNS0095614	Golden flower (tetraploid) 2	12.954
	CNS0095615	Golden flower (tetraploid) 3	13.397
CRA001975	CRR073297	Stem 1	11.362
	CRR073298	Stem 2	7.888
	CRR073299	Stem 3	8.615
	CRR073300	Leaf 1	9.417
	CRR073301	Leaf 2	9.023
	CRR073302	Leaf 3	9.135
	CRR073303	Juvenile bud 1	9.001
	CRR073304	Juvenile bud 2	13.453
	CRR073305	Juvenile bud 3	5.960
	CRR073306	Third green 1	6.930
	CRR073307	Third green 2	10.985
	CRR073308	Third green 3	9.543
	CRR073309	Second white 1	2.564
	CRR073310	Second white 2	4.315
	CRR073311	Second white 3	1.099
	CRR073312	Silver flowering 1	7.798
	CRR073313	Silver flowering 2	5.693
	CRR073314	Silver flowering 3	3.139
	CRR073315	Gold flowering 1	13.378
	CRR073316	Gold flowering 2	11.874
	CRR073317	Gold flowering 3	5.525
	CRR073318	Tawny withering 1	8.849
	CRR073319	Tawny withering 2	11.631
	CRR073320	Tawny withering 3	7.486