Gene detail

Detail information of GWHGAAZE004695

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007148198.1	1.82808E-50	hypothetical protein PHAVU_006G188300g [Phaseolus vulgaris]
Swissprot	tr\|Q9FZA4\|DOF14_ARATH	8E-29	Dof zinc finger protein DOF1.4
trEMBL	tr\|V7BQC5\|V7BQC5_PHAVU	7E-51	Uncharacterized protein {ECO:0000313\|EMBL:ESW20192.1}
TAIR10	AT1G07640.2	2E-23	Dof-type zinc finger DNA-binding family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	120877299	120877949	+
GWHAAZE00000001	mRNA	120877299	120877949	+
GWHAAZE00000001	exon	120877299	120877949	+
GWHAAZE00000001	CDS	120877299	120877949	+

Transcript Sequence
>GWHTAAZE004701 ATGCAATCGGAGCCGTTGAAATGTCCGAGATGTGATTCCATAAACACAAAGTTCTGTTACTACAACAATTACAACAAATCACAGCCTCGCCATTTTTGTAAAGCTTGTAAAAGGCACTGGACCAAAGGTGGTACTCTTCGCAATGTCCCCGTTGGCGGTGGCCGGAAAAACAAGCGAAGCAAAAGGTCTAATTCCATCAGTAGGCCTAAAAGTCAAGTGCAATTGGGTATTCAAATCCACCCACAATCCCAAAATCAAGTGCCTGAAAACGACACAATCAATAGCTTCACTGCCAAAATTTTGGGCAACAATGGTAGTTTCTTGGGTTTAAATCTACCGGTGCCTCAAAATGAAGGCCTACAGTTTTCATTTTCAAACTTGAGCAATTTCGCCACGAACCCATGTTTTCAATCATCGATTGATTATAAATATGAGTCGAAACTAAAAGCTATTGAGGATCCTGCTGGGATGGGAAGCAGCATTAATGTTGACGGTAATCAAACGTGGGATCAGGTTCCAAGTACAAGCACTAGTGTGATGGAGCTGCAGCCTAATTACTGGAATTGGAACGATATGGTTTCGGCTGATTTGAATATACCATGGGATGATGATGAAAATTATATTACAGAGAGAGTGGACGTACCACCCTAG

Network for GWHGAAZE004695

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02701.16	zf-Dof	5	59	5.70E-32

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	C2C2-Dof

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	18.249
	SRR3591706	second leaf	1.817
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	12.701
	SRR3591709	Stem	12.172
	SRR3591710	White floral bud	5.273
	SRR3591711	White flower	9.237
	SRR3591712	Green floral bud	6.883
	SRR3591713	Yellow flower	1.050
SRP173429	SRR8316895	Juvenile bud stage	5.210
	SRR8316896	Juvenile bud stage	3.749
	SRR8316897	Juvenile bud stage	3.229
	SRR8316894	Third green stage	2.626
	SRR8316900	Third green stage	3.414
	SRR8316901	Third green stage	3.897
	SRR8316898	Complete white stage	2.160
	SRR8316899	Complete white stage	7.081
	SRR8316903	Complete white stage	3.188
	SRR8316902	Silver flowering stage	7.555
	SRR8316904	Silver flowering stage	6.056
	SRR8316905	Silver flowering stage	0.185
	SRR8316906	Gold flowering stage	0.573
	SRR8316907	Gold flowering stage	3.861
	SRR8316908	Gold flowering stage	0.953
SRP132670	SRR6706286	Control	3.405
	SRR6706287	Light intensity 50%	3.904
	SRR6706288	Light intensity 20%	3.164
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.207
	CNS0095593	Slightly white alabastrum(diploid) 2	7.506
	CNS0095594	Slightly white alabastrum(diploid) 3	2.463
	CNS0095595	Whole white alabastrum(diploid) 2	4.271
	CNS0095596	Whole white alabastrum(diploid) 3	2.512
	CNS0095597	Whole white alabastrum(diploid) 4	3.008
	CNS0095598	Silvery flower (diploied) 1	3.076
	CNS0095599	Silvery flower (diploied) 2	4.063
	CNS0095600	Silvery flower (diploied) 3	5.813
	CNS0095601	Golden flower (diploid) 1	3.183
	CNS0095602	Golden flower (diploid) 2	3.546
	CNS0095603	Golden flower (diploid) 3	2.371
	CNS0095604	Slightly white alabastrum(tetraploid) 1	9.929
	CNS0095605	Slightly white alabastrum(tetraploid) 2	6.908
	CNS0095606	Slightly white alabastrum(tetraploid) 3	16.332
	CNS0095607	Whole white alabastrum(tetraploid) 1	4.551
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.991
	CNS0095609	Whole white alabastrum(tetraploid) 3	5.735
	CNS0095610	Silvery flower (diploied) 1	7.564
	CNS0095611	Silvery flower (diploied) 2	3.552
	CNS0095612	Silvery flower (diploied) 3	3.192
	CNS0095613	Golden flower (tetraploid) 1	1.101
	CNS0095614	Golden flower (tetraploid) 2	2.889
	CNS0095615	Golden flower (tetraploid) 3	0.508
CRA001975	CRR073297	Stem 1	0.555
	CRR073298	Stem 2	1.718
	CRR073299	Stem 3	1.702
	CRR073300	Leaf 1	0.369
	CRR073301	Leaf 2	1.080
	CRR073302	Leaf 3	2.155
	CRR073303	Juvenile bud 1	0.807
	CRR073304	Juvenile bud 2	0.174
	CRR073305	Juvenile bud 3	0.393
	CRR073306	Third green 1	0.023
	CRR073307	Third green 2	0.069
	CRR073308	Third green 3	0.361
	CRR073309	Second white 1	0.258
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.413
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.279
	CRR073317	Gold flowering 3	0.065
	CRR073318	Tawny withering 1	1.196
	CRR073319	Tawny withering 2	0.405
	CRR073320	Tawny withering 3	2.616