Gene detail

Detail information of GWHGAAZE005142

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008456600.1	1.20539E-75	PREDICTED: ferredoxin, root R-B2-like [Cucumis melo]
Swissprot	tr\|P27788\|FER3_MAIZE	1E-61	Ferredoxin-3, chloroplastic (Precursor)
trEMBL	tr\|A0A0A0KNA3\|A0A0A0KNA3_CUCSA	1E-74	Uncharacterized protein {ECO:0000313\|EMBL:KGN51038.1}
TAIR10	AT2G27510.1	2E-45	ferredoxin 3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	3257213	3257680	+
GWHAAZE00000002	mRNA	3257213	3257680	+
GWHAAZE00000002	exon	3257213	3257680	+
GWHAAZE00000002	CDS	3257213	3257680	+

Transcript Sequence
>GWHTAAZE005148 ATGTCGACTGTGACAATCCCTTCATCCTGCTTCTTCAGAACCACAGCCCCAACCAGGTCTGGTGCCTTGTTCAAGAATCCCCGGTCTTTGGGATCCATGAAGAGCGTTTCTAAAGCATTTGGCTTGAAGAAGTCGTTGTCTTCTTCTCATTCTTCGTTGGGAGTAGCTGTAATGGCAGCATATAAAGTGAAACTAGTTGGACCGGATGGAGTAGAGAATGAATTCGAGGCACCTGGTGATGCATACATACTTGATTCTGCAGAAAATGCGGGACTAGAACTGCCCTACTCTTGTAGGGCAGGTGCTTGCTCAACCTGTGCTGGGCAGATAGTAGCGGGAACTGTGGATCAATCAGAGGGCTCGTTCCTGGACGATCGGCAACTGGAGAAAGGGTATGTGCTCACCTGTGTTGCTTACCCGACTTCGGATTGTGTGATACACACCCACAAGGAAGGTGATCTCTACTGA

Network for GWHGAAZE005142

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00111.28	Fer2	68	141	4.40E-19

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02639	petF	Photosynthesis	map00195

Gene Ontology

GO term	Ontology	Name
GO:0022900	biological_process	electron transport chain
GO:0009055	molecular_function	electron transfer activity
GO:0051536	molecular_function	iron-sulfur cluster binding
GO:0051537	molecular_function	2 iron, 2 sulfur cluster binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	11.122
	SRR3591706	second leaf	11.208
	SRR3591707	mature leaf	23.243
	SRR3591708	Shoot apex	13.273
	SRR3591709	Stem	43.646
	SRR3591710	White floral bud	42.100
	SRR3591711	White flower	144.268
	SRR3591712	Green floral bud	48.307
	SRR3591713	Yellow flower	250.060
SRP173429	SRR8316895	Juvenile bud stage	15.339
	SRR8316896	Juvenile bud stage	37.117
	SRR8316897	Juvenile bud stage	19.956
	SRR8316894	Third green stage	9.395
	SRR8316900	Third green stage	35.153
	SRR8316901	Third green stage	27.069
	SRR8316898	Complete white stage	24.664
	SRR8316899	Complete white stage	58.398
	SRR8316903	Complete white stage	38.659
	SRR8316902	Silver flowering stage	20.298
	SRR8316904	Silver flowering stage	24.330
	SRR8316905	Silver flowering stage	11.013
	SRR8316906	Gold flowering stage	72.842
	SRR8316907	Gold flowering stage	70.825
	SRR8316908	Gold flowering stage	78.230
SRP132670	SRR6706286	Control	46.449
	SRR6706287	Light intensity 50%	45.376
	SRR6706288	Light intensity 20%	50.252
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	31.050
	CNS0095593	Slightly white alabastrum(diploid) 2	15.328
	CNS0095594	Slightly white alabastrum(diploid) 3	30.830
	CNS0095595	Whole white alabastrum(diploid) 2	18.118
	CNS0095596	Whole white alabastrum(diploid) 3	27.648
	CNS0095597	Whole white alabastrum(diploid) 4	17.246
	CNS0095598	Silvery flower (diploied) 1	54.862
	CNS0095599	Silvery flower (diploied) 2	58.019
	CNS0095600	Silvery flower (diploied) 3	127.765
	CNS0095601	Golden flower (diploid) 1	102.442
	CNS0095602	Golden flower (diploid) 2	163.628
	CNS0095603	Golden flower (diploid) 3	157.215
	CNS0095604	Slightly white alabastrum(tetraploid) 1	26.085
	CNS0095605	Slightly white alabastrum(tetraploid) 2	22.076
	CNS0095606	Slightly white alabastrum(tetraploid) 3	34.199
	CNS0095607	Whole white alabastrum(tetraploid) 1	19.289
	CNS0095608	Whole white alabastrum(tetraploid) 2	27.668
	CNS0095609	Whole white alabastrum(tetraploid) 3	66.887
	CNS0095610	Silvery flower (diploied) 1	216.736
	CNS0095611	Silvery flower (diploied) 2	293.133
	CNS0095612	Silvery flower (diploied) 3	310.854
	CNS0095613	Golden flower (tetraploid) 1	314.115
	CNS0095614	Golden flower (tetraploid) 2	275.166
	CNS0095615	Golden flower (tetraploid) 3	414.253
CRA001975	CRR073297	Stem 1	20.040
	CRR073298	Stem 2	26.392
	CRR073299	Stem 3	39.055
	CRR073300	Leaf 1	23.695
	CRR073301	Leaf 2	27.237
	CRR073302	Leaf 3	34.554
	CRR073303	Juvenile bud 1	40.831
	CRR073304	Juvenile bud 2	96.329
	CRR073305	Juvenile bud 3	34.190
	CRR073306	Third green 1	39.041
	CRR073307	Third green 2	31.754
	CRR073308	Third green 3	24.697
	CRR073309	Second white 1	158.342
	CRR073310	Second white 2	105.109
	CRR073311	Second white 3	106.718
	CRR073312	Silver flowering 1	173.568
	CRR073313	Silver flowering 2	240.985
	CRR073314	Silver flowering 3	146.686
	CRR073315	Gold flowering 1	9.039
	CRR073316	Gold flowering 2	6.112
	CRR073317	Gold flowering 3	12.258
	CRR073318	Tawny withering 1	18.150
	CRR073319	Tawny withering 2	26.374
	CRR073320	Tawny withering 3	12.497