Gene detail

Detail information of GWHGAAZE005366

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009803153.1	1.80763E-56	PREDICTED: uncharacterized protein LOC104248568 [Nicotiana sylvestris]
Swissprot	tr\|Q8LFR2\|DRE2C_ARATH	3E-39	Dehydration-responsive element-binding protein 2C
trEMBL	tr\|K4D1X9\|K4D1X9_SOLLC	2E-52	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc10g076370.1.1}
TAIR10	AT2G40340.1	2E-27	Integrase-type DNA-binding superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	6770014	6770634	+
GWHAAZE00000002	mRNA	6770014	6770634	+
GWHAAZE00000002	exon	6770014	6770634	+
GWHAAZE00000002	CDS	6770014	6770634	+

Transcript Sequence
>GWHTAAZE005372 ATGGGATATATTGGGTTCAGAATCAAATCAAGGAAGAGGAGGAATGGGTGTGAATCCTTAGAGCAGATTCTATTGAAGTGGAAGAATTACAACCACCAACAGCTTGATTCTACGGTAGATGATGATAGCGGAGTAAAAAGGAAGCGCATGGCTCCGGGCAAGGGATCAAAGAAGGGGTGTATGATAGGTAAAGGTGGTCCGGAGAATTTACGCTGCCCATACAGAGGAGTTAGACAGAGGACTTGGGGCAAGTGGGTTGCCGAGATTCGTGAGCCAACTTTTATTAGCACGAATGAACGAAAGAAACCTAGCCGACTTTGGCTTGGTACATTTTCATCTGCTGTTGACGCAGCCCTTGCCTATGACGAGGCCGCTAAGGTCATGTATGGTCCCAACGCAATACTTAATTTCCCTGGATACTGTACTAAACCAACGGACTCTAATGATTCATCTGAACAATGCGATAATAAACCAACAGACTTGTCTAATGATTCATCTGAACAGTGTGATACTAAATCAATGGACTTGTCTAATGATTCGTTTGGAAATTGCAATACTAAACCAAGAGACTTGTCTAGTAATTCATCGAAAAATGCGAGATTGACGTGGCTGAGGATATAG

Network for GWHGAAZE005366

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	74	130	3.10E-13

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.021
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.232
	SRR3591709	Stem	1.936
	SRR3591710	White floral bud	0.356
	SRR3591711	White flower	2.500
	SRR3591712	Green floral bud	0.478
	SRR3591713	Yellow flower	1.605
SRP173429	SRR8316895	Juvenile bud stage	0.547
	SRR8316896	Juvenile bud stage	0.516
	SRR8316897	Juvenile bud stage	0.650
	SRR8316894	Third green stage	0.304
	SRR8316900	Third green stage	0.526
	SRR8316901	Third green stage	0.406
	SRR8316898	Complete white stage	0.398
	SRR8316899	Complete white stage	1.419
	SRR8316903	Complete white stage	0.294
	SRR8316902	Silver flowering stage	0.586
	SRR8316904	Silver flowering stage	0.844
	SRR8316905	Silver flowering stage	0.290
	SRR8316906	Gold flowering stage	2.985
	SRR8316907	Gold flowering stage	2.871
	SRR8316908	Gold flowering stage	3.054
SRP132670	SRR6706286	Control	0.353
	SRR6706287	Light intensity 50%	0.459
	SRR6706288	Light intensity 20%	0.214
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.068
	CNS0095593	Slightly white alabastrum(diploid) 2	0.364
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.271
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.321
	CNS0095598	Silvery flower (diploied) 1	0.481
	CNS0095599	Silvery flower (diploied) 2	0.205
	CNS0095600	Silvery flower (diploied) 3	0.947
	CNS0095601	Golden flower (diploid) 1	0.231
	CNS0095602	Golden flower (diploid) 2	0.942
	CNS0095603	Golden flower (diploid) 3	1.677
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.270
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.255
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.344
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.273
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.094
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (diploied) 1	1.175
	CNS0095611	Silvery flower (diploied) 2	0.037
	CNS0095612	Silvery flower (diploied) 3	1.220
	CNS0095613	Golden flower (tetraploid) 1	0.758
	CNS0095614	Golden flower (tetraploid) 2	0.491
	CNS0095615	Golden flower (tetraploid) 3	2.085
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.068
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.627
	CRR073301	Leaf 2	0.309
	CRR073302	Leaf 3	0.540
	CRR073303	Juvenile bud 1	1.200
	CRR073304	Juvenile bud 2	0.748
	CRR073305	Juvenile bud 3	0.957
	CRR073306	Third green 1	3.269
	CRR073307	Third green 2	1.648
	CRR073308	Third green 3	2.465
	CRR073309	Second white 1	1.427
	CRR073310	Second white 2	5.684
	CRR073311	Second white 3	4.445
	CRR073312	Silver flowering 1	4.790
	CRR073313	Silver flowering 2	1.027
	CRR073314	Silver flowering 3	3.786
	CRR073315	Gold flowering 1	0.053
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.228
	CRR073319	Tawny withering 2	0.032
	CRR073320	Tawny withering 3	0.936