Gene detail

Detail information of GWHGAAZE005815

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002281777.1	1.64003E-82	PREDICTED: mRNA-decapping enzyme-like protein [Vitis vinifera]
Swissprot	tr\|Q9SJF3\|DCP1_ARATH	2E-76	mRNA-decapping enzyme-like protein
trEMBL	tr\|D7TJB2\|D7TJB2_VITVI	6E-83	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI30338.3}
TAIR10	AT1G08370.1	7E-63	decapping 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	14349803	14352654	+
GWHAAZE00000002	mRNA	14349803	14352654	+
GWHAAZE00000002	exon	14349803	14349961	+
GWHAAZE00000002	exon	14350642	14350685	+
GWHAAZE00000002	exon	14350947	14351044	+
GWHAAZE00000002	exon	14352458	14352654	+
GWHAAZE00000002	CDS	14349803	14349961	+
GWHAAZE00000002	CDS	14350642	14350685	+
GWHAAZE00000002	CDS	14350947	14351044	+
GWHAAZE00000002	CDS	14352458	14352654	+

Transcript Sequence
>GWHTAAZE005823 ATGTCTCAGAGCGGAAAGCTAATGCCAAATCTGGACCAACACAGCACTAAACTCCTCAACCTTACTGTTCTCCAGAGAATGGATCCGTATATTGAAGAGATCTTAATCACCGCCGCTCACGTCACCTTTTACGGATTCAACATCGAGCTCAACCAATGGAGTCGCAAGGATGTGGAAGGGTCACTTTTTGTTGTCAAGAGGTGTTATTTGGAGATTAATCGACTTACTATTGTTTTTGATGTCCATGGTAGGAACACTCAACCGCGATTCCAGTTCATTGTCATGAATAGGCGAAATACAGAAAATCTCGTGGAGAATCTCCTGGGAGATTTTGAGTATGAACTTCAAGTTCCATATCTATTGTATCGTAATGGAGCCCAAGAAGTTAACGGTATCTGGTTCTATAATTCACGTGAATGTGAGGATGTTGCAAATTTATTTACTAGGTACTCTTTCTTCTTTGCTGTCCCGCGCTTAGAAAAATATATTATATTCTAA

Network for GWHGAAZE005815

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF06058.14	DCP1	17	148	6.70E-41

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K12611	DCP1B	RNA degradation	map03018

Gene Ontology

GO term	Ontology	Name
GO:0000290	biological_process	deadenylation-dependent decapping of nuclear-transcribed mRNA
GO:0043085	biological_process	positive regulation of catalytic activity
GO:0008047	molecular_function	enzyme activator activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	34.972
	SRR3591706	second leaf	17.752
	SRR3591707	mature leaf	15.930
	SRR3591708	Shoot apex	31.208
	SRR3591709	Stem	27.207
	SRR3591710	White floral bud	28.794
	SRR3591711	White flower	32.944
	SRR3591712	Green floral bud	29.298
	SRR3591713	Yellow flower	19.775
SRP173429	SRR8316895	Juvenile bud stage	17.046
	SRR8316896	Juvenile bud stage	23.527
	SRR8316897	Juvenile bud stage	13.713
	SRR8316894	Third green stage	11.295
	SRR8316900	Third green stage	30.440
	SRR8316901	Third green stage	26.639
	SRR8316898	Complete white stage	11.655
	SRR8316899	Complete white stage	28.875
	SRR8316903	Complete white stage	19.297
	SRR8316902	Silver flowering stage	10.634
	SRR8316904	Silver flowering stage	15.770
	SRR8316905	Silver flowering stage	7.306
	SRR8316906	Gold flowering stage	21.898
	SRR8316907	Gold flowering stage	24.183
	SRR8316908	Gold flowering stage	26.384
SRP132670	SRR6706286	Control	30.690
	SRR6706287	Light intensity 50%	30.493
	SRR6706288	Light intensity 20%	33.357
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	14.911
	CNS0095593	Slightly white alabastrum(diploid) 2	18.133
	CNS0095594	Slightly white alabastrum(diploid) 3	14.220
	CNS0095595	Whole white alabastrum(diploid) 2	16.648
	CNS0095596	Whole white alabastrum(diploid) 3	11.744
	CNS0095597	Whole white alabastrum(diploid) 4	13.837
	CNS0095598	Silvery flower (diploied) 1	17.478
	CNS0095599	Silvery flower (diploied) 2	18.736
	CNS0095600	Silvery flower (diploied) 3	26.985
	CNS0095601	Golden flower (diploid) 1	16.259
	CNS0095602	Golden flower (diploid) 2	25.816
	CNS0095603	Golden flower (diploid) 3	22.768
	CNS0095604	Slightly white alabastrum(tetraploid) 1	18.351
	CNS0095605	Slightly white alabastrum(tetraploid) 2	17.164
	CNS0095606	Slightly white alabastrum(tetraploid) 3	39.351
	CNS0095607	Whole white alabastrum(tetraploid) 1	11.259
	CNS0095608	Whole white alabastrum(tetraploid) 2	7.323
	CNS0095609	Whole white alabastrum(tetraploid) 3	27.499
	CNS0095610	Silvery flower (diploied) 1	25.983
	CNS0095611	Silvery flower (diploied) 2	29.468
	CNS0095612	Silvery flower (diploied) 3	21.135
	CNS0095613	Golden flower (tetraploid) 1	13.653
	CNS0095614	Golden flower (tetraploid) 2	22.032
	CNS0095615	Golden flower (tetraploid) 3	17.666
CRA001975	CRR073297	Stem 1	24.192
	CRR073298	Stem 2	20.568
	CRR073299	Stem 3	22.264
	CRR073300	Leaf 1	24.953
	CRR073301	Leaf 2	19.328
	CRR073302	Leaf 3	25.221
	CRR073303	Juvenile bud 1	20.991
	CRR073304	Juvenile bud 2	20.820
	CRR073305	Juvenile bud 3	25.119
	CRR073306	Third green 1	8.566
	CRR073307	Third green 2	10.072
	CRR073308	Third green 3	8.060
	CRR073309	Second white 1	13.369
	CRR073310	Second white 2	12.399
	CRR073311	Second white 3	12.461
	CRR073312	Silver flowering 1	13.275
	CRR073313	Silver flowering 2	9.382
	CRR073314	Silver flowering 3	9.193
	CRR073315	Gold flowering 1	8.008
	CRR073316	Gold flowering 2	13.207
	CRR073317	Gold flowering 3	20.393
	CRR073318	Tawny withering 1	18.661
	CRR073319	Tawny withering 2	13.093
	CRR073320	Tawny withering 3	24.030