Gene detail

Detail information of GWHGAAZE005929

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011082301.1	2.81704E-59	PREDICTED: RNA polymerase II transcriptional coactivator KELP [Sesamum indicum]
Swissprot	tr\|O65155\|KELP_ARATH	7E-56	RNA polymerase II transcriptional coactivator KELP
trEMBL	tr\|A0A068UVC3\|A0A068UVC3_COFCA	1E-59	Coffea canephora DH200=94 genomic scaffold, scaffold_62 {ECO:0000313\|EMBL:CDP12179.1}
TAIR10	AT4G10920.2	9E-34	transcriptional coactivator p15 (PC4) family protein (KELP)

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	16357739	16363565	-
GWHAAZE00000002	mRNA	16357739	16363565	-
GWHAAZE00000002	exon	16363230	16363565	-
GWHAAZE00000002	exon	16362279	16362409	-
GWHAAZE00000002	exon	16360086	16360185	-
GWHAAZE00000002	exon	16357739	16357858	-
GWHAAZE00000002	CDS	16363230	16363565	-
GWHAAZE00000002	CDS	16362279	16362409	-
GWHAAZE00000002	CDS	16360086	16360185	-
GWHAAZE00000002	CDS	16357739	16357858	-

Transcript Sequence
>GWHTAAZE005937 ATGGAAATCGAAGAAAAGAAAATGGAAGCAGAACTTCAAAAGAAAATAGAAGAAACTGTTGTGGATATTCTGAAGAAATCAAACATGGACGAGACTACCGAGTATAAGATTCGCAAAGCGGCCTCAGAAGAACTGGGAGTAGACCTCTCCAGATCGGATCGCAAGCGATTTGTCAGGCAAGTCGTCGAGTCTTACCTAGATGAACAAAGGTTGAAGACCGAAGCAGCACAGGAAGAAGAAGAAGAAGAAGAGGAAGACGAGGAAGAACCGGCGGGAAAGAAGGGTGGTGCCGGTGCAAAAGAGTACGACGACGATGGCGATCTTATCATCTGTAGACTATCGGATAAGAGGAGAGTGACCATTACGGATTTTAGGGGGAAGACTTTGGTGTCAATGAGGGAATACTACAAAAAGGATGGCAAAGAGCTCCCTACTTCTAAAGGTATTAATTTACGACCTTTTATTATAAGCCTCCCAAGGTTTAAATCTGGCTGGGCAGGCCCTTGCAAATCAAATCAACAGGATCCTAAATCACATGTCGTCTTGTCGCTGGCCGAAATAACTCGGAGGTGGCCATGTGTTGGTTTCTCAGGAATAAGCTTGACAGCAGAGCAGTGGTCAACCTTCAGTAAAAATGTACCTGCAATTGAGAAAGCCATCAGGAAAATGGAGTCGAGGTTGAACTGA

Network for GWHGAAZE005929

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF08766.12	DEK_C	13	66	2.60E-13
PF02229.17	PC4	111	152	2.90E-16

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	Coactivator p15

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	57.517
	SRR3591706	second leaf	53.156
	SRR3591707	mature leaf	48.990
	SRR3591708	Shoot apex	67.429
	SRR3591709	Stem	63.195
	SRR3591710	White floral bud	67.059
	SRR3591711	White flower	82.767
	SRR3591712	Green floral bud	54.352
	SRR3591713	Yellow flower	63.723
SRP173429	SRR8316895	Juvenile bud stage	38.947
	SRR8316896	Juvenile bud stage	45.355
	SRR8316897	Juvenile bud stage	26.377
	SRR8316894	Third green stage	22.988
	SRR8316900	Third green stage	76.498
	SRR8316901	Third green stage	73.228
	SRR8316898	Complete white stage	40.990
	SRR8316899	Complete white stage	100.286
	SRR8316903	Complete white stage	69.485
	SRR8316902	Silver flowering stage	47.076
	SRR8316904	Silver flowering stage	58.467
	SRR8316905	Silver flowering stage	33.823
	SRR8316906	Gold flowering stage	89.462
	SRR8316907	Gold flowering stage	98.369
	SRR8316908	Gold flowering stage	90.656
SRP132670	SRR6706286	Control	123.949
	SRR6706287	Light intensity 50%	111.654
	SRR6706288	Light intensity 20%	111.871
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	51.829
	CNS0095593	Slightly white alabastrum(diploid) 2	54.975
	CNS0095594	Slightly white alabastrum(diploid) 3	47.517
	CNS0095595	Whole white alabastrum(diploid) 2	46.739
	CNS0095596	Whole white alabastrum(diploid) 3	44.227
	CNS0095597	Whole white alabastrum(diploid) 4	42.677
	CNS0095598	Silvery flower (diploied) 1	63.114
	CNS0095599	Silvery flower (diploied) 2	64.531
	CNS0095600	Silvery flower (diploied) 3	67.427
	CNS0095601	Golden flower (diploid) 1	68.890
	CNS0095602	Golden flower (diploid) 2	56.067
	CNS0095603	Golden flower (diploid) 3	60.406
	CNS0095604	Slightly white alabastrum(tetraploid) 1	45.635
	CNS0095605	Slightly white alabastrum(tetraploid) 2	38.706
	CNS0095606	Slightly white alabastrum(tetraploid) 3	59.828
	CNS0095607	Whole white alabastrum(tetraploid) 1	29.698
	CNS0095608	Whole white alabastrum(tetraploid) 2	34.040
	CNS0095609	Whole white alabastrum(tetraploid) 3	39.188
	CNS0095610	Silvery flower (diploied) 1	70.154
	CNS0095611	Silvery flower (diploied) 2	64.959
	CNS0095612	Silvery flower (diploied) 3	56.975
	CNS0095613	Golden flower (tetraploid) 1	47.977
	CNS0095614	Golden flower (tetraploid) 2	65.206
	CNS0095615	Golden flower (tetraploid) 3	40.662
CRA001975	CRR073297	Stem 1	93.606
	CRR073298	Stem 2	82.005
	CRR073299	Stem 3	84.436
	CRR073300	Leaf 1	94.280
	CRR073301	Leaf 2	97.670
	CRR073302	Leaf 3	88.410
	CRR073303	Juvenile bud 1	93.637
	CRR073304	Juvenile bud 2	86.596
	CRR073305	Juvenile bud 3	64.313
	CRR073306	Third green 1	68.199
	CRR073307	Third green 2	67.974
	CRR073308	Third green 3	71.616
	CRR073309	Second white 1	30.131
	CRR073310	Second white 2	61.861
	CRR073311	Second white 3	38.890
	CRR073312	Silver flowering 1	35.988
	CRR073313	Silver flowering 2	17.671
	CRR073314	Silver flowering 3	24.614
	CRR073315	Gold flowering 1	44.397
	CRR073316	Gold flowering 2	54.583
	CRR073317	Gold flowering 3	13.378
	CRR073318	Tawny withering 1	83.248
	CRR073319	Tawny withering 2	79.110
	CRR073320	Tawny withering 3	83.844