Gene detail

Detail information of GWHGAAZE006156

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ADO95202.1	1.03562E-91	anthocyanidin synthase [Litchi chinensis]
Swissprot	tr\|P51091\|LDOX_MALDO	8E-91	Leucoanthocyanidin dioxygenase
trEMBL	tr\|E3W5V9\|E3W5V9_LITCN	4E-92	Anthocyanidin synthase {ECO:0000313\|EMBL:ADO95202.1} (Fragment)
TAIR10	AT4G22880.2	5E-69	leucoanthocyanidin dioxygenase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	20273987	20274415	+
GWHAAZE00000002	mRNA	20273987	20274415	+
GWHAAZE00000002	exon	20273987	20274415	+
GWHAAZE00000002	CDS	20273987	20274415	+

Transcript Sequence
>GWHTAAZE006164 ATGAAAATCAATTATTATCCCAAATGCCCGCAACCAGAGCTAGCCCTGGGAGTGGAAGCCCACACTGACGTAAGCGCGCTCACCTTCATACTCCACAACATGGTCCCAGGGCTCCAGCTTTTCTACAACGACAAGTGGGTGACGGCCAAGTGCGTGCCCAACTCCATTGTCATGCACATTGGTGACACCATTGAGATTTTGAGTAACGGAAAGTACAAGAGCATTCTTCACCGGGGACTTGTCAATAAAGAGAGGGTTCGAATCTCTTGGGCTGTTTTTTGTGAGCCTCCTAAGGAGAAAATCATCCTCAAGCCGCTCTCGGAGACTACGTCTGAGGCTGAGCCTCCACTATTTCCGCCGCGCACATTTTCTCAGCATATTGAGCACAAGCTGTTCAGGAGGAGCCAAGAAGCTCTTGAGAAGAAATGA

Network for GWHGAAZE006156

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03171.21	2OG-FeII_Oxy	3	96	1.30E-24

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K05277	ANS	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Flavonoid biosynthesis	map00941

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0016491	molecular_function	oxidoreductase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	11.972
	SRR3591706	second leaf	1.359
	SRR3591707	mature leaf	0.259
	SRR3591708	Shoot apex	2.703
	SRR3591709	Stem	43.642
	SRR3591710	White floral bud	10.267
	SRR3591711	White flower	7.309
	SRR3591712	Green floral bud	49.764
	SRR3591713	Yellow flower	0.640
SRP173429	SRR8316895	Juvenile bud stage	48.285
	SRR8316896	Juvenile bud stage	55.418
	SRR8316897	Juvenile bud stage	9.348
	SRR8316894	Third green stage	8.526
	SRR8316900	Third green stage	16.702
	SRR8316901	Third green stage	15.799
	SRR8316898	Complete white stage	2.159
	SRR8316899	Complete white stage	24.251
	SRR8316903	Complete white stage	7.253
	SRR8316902	Silver flowering stage	1.604
	SRR8316904	Silver flowering stage	1.101
	SRR8316905	Silver flowering stage	0.265
	SRR8316906	Gold flowering stage	0.333
	SRR8316907	Gold flowering stage	1.888
	SRR8316908	Gold flowering stage	2.494
SRP132670	SRR6706286	Control	14.696
	SRR6706287	Light intensity 50%	17.101
	SRR6706288	Light intensity 20%	15.846
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	110.724
	CNS0095593	Slightly white alabastrum(diploid) 2	57.250
	CNS0095594	Slightly white alabastrum(diploid) 3	210.233
	CNS0095595	Whole white alabastrum(diploid) 2	61.907
	CNS0095596	Whole white alabastrum(diploid) 3	65.923
	CNS0095597	Whole white alabastrum(diploid) 4	86.710
	CNS0095598	Silvery flower (diploied) 1	26.219
	CNS0095599	Silvery flower (diploied) 2	20.967
	CNS0095600	Silvery flower (diploied) 3	16.727
	CNS0095601	Golden flower (diploid) 1	15.330
	CNS0095602	Golden flower (diploid) 2	14.660
	CNS0095603	Golden flower (diploid) 3	10.632
	CNS0095604	Slightly white alabastrum(tetraploid) 1	49.137
	CNS0095605	Slightly white alabastrum(tetraploid) 2	67.650
	CNS0095606	Slightly white alabastrum(tetraploid) 3	34.231
	CNS0095607	Whole white alabastrum(tetraploid) 1	84.406
	CNS0095608	Whole white alabastrum(tetraploid) 2	56.775
	CNS0095609	Whole white alabastrum(tetraploid) 3	32.888
	CNS0095610	Silvery flower (diploied) 1	2.046
	CNS0095611	Silvery flower (diploied) 2	6.107
	CNS0095612	Silvery flower (diploied) 3	5.317
	CNS0095613	Golden flower (tetraploid) 1	2.406
	CNS0095614	Golden flower (tetraploid) 2	1.520
	CNS0095615	Golden flower (tetraploid) 3	0.481
CRA001975	CRR073297	Stem 1	27.568
	CRR073298	Stem 2	19.496
	CRR073299	Stem 3	18.191
	CRR073300	Leaf 1	7.911
	CRR073301	Leaf 2	5.813
	CRR073302	Leaf 3	8.377
	CRR073303	Juvenile bud 1	0.678
	CRR073304	Juvenile bud 2	4.995
	CRR073305	Juvenile bud 3	5.783
	CRR073306	Third green 1	4.376
	CRR073307	Third green 2	26.470
	CRR073308	Third green 3	5.373
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	1.888
	CRR073311	Second white 3	0.311
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.211
	CRR073317	Gold flowering 3	0.194
	CRR073318	Tawny withering 1	12.627
	CRR073319	Tawny withering 2	15.509
	CRR073320	Tawny withering 3	10.804