Gene detail

Detail information of GWHGAAZE006256

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009758386.1	2.93457E-78	PREDICTED: phosphatidylserine decarboxylase proenzyme 1, mitochondrial-like [Nicotiana sylvestris]
Swissprot	tr\|Q84V22\|PSD1_ARATH	1E-73	Phosphatidylserine decarboxylase 1 alpha chain (Precursor)
trEMBL	tr\|M1AV33\|M1AV33_SOLTU	8E-78	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400031011}
TAIR10	AT4G16700.1	2E-61	phosphatidylserine decarboxylase 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	22007772	22010841	-
GWHAAZE00000002	mRNA	22007772	22010841	-
GWHAAZE00000002	exon	22010749	22010841	-
GWHAAZE00000002	exon	22009279	22009356	-
GWHAAZE00000002	exon	22008594	22008716	-
GWHAAZE00000002	exon	22007772	22007933	-
GWHAAZE00000002	CDS	22010749	22010841	-
GWHAAZE00000002	CDS	22009279	22009356	-
GWHAAZE00000002	CDS	22008594	22008716	-
GWHAAZE00000002	CDS	22007772	22007933	-

Transcript Sequence
>GWHTAAZE006264 ATGTACTACATTATTTGTTTTACAGGTCGCCTTTTCCCTGTGAATGAACGGGCTACAAGAACGATCAGAAACCTCTATGTTGAGAATGAAAGAGTTGTGCTTGAAGGTCAATGGAAAGAAGGTTTTATGGCATTGGCAGCTATTGGTGCAACAAATATTGGTTCTATTGAGCTTTTTATTGAACCTGCACTGCGAACCAATAGGCCAAGAAAGAAGTTACTACATTCAGAGCCACCTGATGAGAGGATCTATGAACCCGAAGGCGTTGGAGTGACCCTCAAGAAAGGGGATGAGGTAGCCGCATTCAACATGGGATCAACAGTGGTGCTTGTCTTCCAGGCTCCCATTTCAAAATTTCCGAAGGAAAGATCATTGTCATCAGAATTCAGGTTCTCTGTGAGACGTGGGGATAGAATTCGTGTGGGAGAAGCACTTGGGAGGTGGCACAACTCATAG

Network for GWHGAAZE006256

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02666.16	PS_Dcarbxylase	7	146	3.30E-28

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01613	psd, PISD	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Glycerophospholipid metabolism	map00564

Gene Ontology

GO term	Ontology	Name
GO:0008654	biological_process	phospholipid biosynthetic process
GO:0004609	molecular_function	phosphatidylserine decarboxylase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	10.605
	SRR3591706	second leaf	11.910
	SRR3591707	mature leaf	8.663
	SRR3591708	Shoot apex	20.905
	SRR3591709	Stem	10.308
	SRR3591710	White floral bud	5.873
	SRR3591711	White flower	8.827
	SRR3591712	Green floral bud	12.892
	SRR3591713	Yellow flower	10.349
SRP173429	SRR8316895	Juvenile bud stage	9.404
	SRR8316896	Juvenile bud stage	15.496
	SRR8316897	Juvenile bud stage	6.727
	SRR8316894	Third green stage	6.746
	SRR8316900	Third green stage	14.861
	SRR8316901	Third green stage	15.821
	SRR8316898	Complete white stage	6.144
	SRR8316899	Complete white stage	19.410
	SRR8316903	Complete white stage	7.572
	SRR8316902	Silver flowering stage	3.708
	SRR8316904	Silver flowering stage	5.829
	SRR8316905	Silver flowering stage	2.336
	SRR8316906	Gold flowering stage	8.088
	SRR8316907	Gold flowering stage	8.037
	SRR8316908	Gold flowering stage	8.153
SRP132670	SRR6706286	Control	7.736
	SRR6706287	Light intensity 50%	8.813
	SRR6706288	Light intensity 20%	8.758
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	15.112
	CNS0095593	Slightly white alabastrum(diploid) 2	15.117
	CNS0095594	Slightly white alabastrum(diploid) 3	11.063
	CNS0095595	Whole white alabastrum(diploid) 2	8.351
	CNS0095596	Whole white alabastrum(diploid) 3	9.797
	CNS0095597	Whole white alabastrum(diploid) 4	7.838
	CNS0095598	Silvery flower (diploied) 1	13.432
	CNS0095599	Silvery flower (diploied) 2	10.893
	CNS0095600	Silvery flower (diploied) 3	8.359
	CNS0095601	Golden flower (diploid) 1	8.832
	CNS0095602	Golden flower (diploid) 2	7.387
	CNS0095603	Golden flower (diploid) 3	7.328
	CNS0095604	Slightly white alabastrum(tetraploid) 1	19.058
	CNS0095605	Slightly white alabastrum(tetraploid) 2	9.655
	CNS0095606	Slightly white alabastrum(tetraploid) 3	18.599
	CNS0095607	Whole white alabastrum(tetraploid) 1	13.358
	CNS0095608	Whole white alabastrum(tetraploid) 2	8.157
	CNS0095609	Whole white alabastrum(tetraploid) 3	14.755
	CNS0095610	Silvery flower (diploied) 1	8.079
	CNS0095611	Silvery flower (diploied) 2	7.681
	CNS0095612	Silvery flower (diploied) 3	10.181
	CNS0095613	Golden flower (tetraploid) 1	7.415
	CNS0095614	Golden flower (tetraploid) 2	10.654
	CNS0095615	Golden flower (tetraploid) 3	6.935
CRA001975	CRR073297	Stem 1	20.635
	CRR073298	Stem 2	15.960
	CRR073299	Stem 3	14.224
	CRR073300	Leaf 1	17.924
	CRR073301	Leaf 2	13.655
	CRR073302	Leaf 3	14.387
	CRR073303	Juvenile bud 1	14.122
	CRR073304	Juvenile bud 2	8.297
	CRR073305	Juvenile bud 3	10.433
	CRR073306	Third green 1	2.798
	CRR073307	Third green 2	2.421
	CRR073308	Third green 3	3.135
	CRR073309	Second white 1	3.895
	CRR073310	Second white 2	6.761
	CRR073311	Second white 3	3.551
	CRR073312	Silver flowering 1	2.859
	CRR073313	Silver flowering 2	2.845
	CRR073314	Silver flowering 3	2.833
	CRR073315	Gold flowering 1	5.843
	CRR073316	Gold flowering 2	9.273
	CRR073317	Gold flowering 3	5.358
	CRR073318	Tawny withering 1	12.414
	CRR073319	Tawny withering 2	11.916
	CRR073320	Tawny withering 3	12.671