Gene detail

Detail information of GWHGAAZE006465

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP04500.1	2.1709E-131	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q9FGK5\|RAA5A_ARATH	3E-125	Ras-related protein RABA5a
trEMBL	tr\|A0A068U7G7\|A0A068U7G7_COFCA	8E-132	Coffea canephora DH200=94 genomic scaffold, scaffold_12 {ECO:0000313\|EMBL:CDP04500.1}
TAIR10	AT5G47520.1	3E-99	RAB GTPase homolog A5A

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	26047895	26049199	-
GWHAAZE00000002	mRNA	26047895	26049199	-
GWHAAZE00000002	exon	26047895	26048238	-
GWHAAZE00000002	exon	26048875	26049199	-
GWHAAZE00000002	CDS	26048875	26049199	-
GWHAAZE00000002	CDS	26047895	26048238	-

Transcript Sequence
>GWHTAAZE006473 ATGGAAGAACAAACTAAAGATTACCTTTTCAAGATTGTATTGATTGGGGATTCAGCTGTTGGGAAATCAAACTTGCTTGCTAGATTTGCAAGGCACGAATTTTACCCTAATTCGAAATCGACAATAGGAGTGGAGTTCCAAACACAGAAGATTGAAATTAATGGGAAGGTAGTAAAGGCACAGGTTTGGGACACGGCTGGTCAAGAGCGGTTCAAGGCTGTCACTTCTGCTTATTATAGGGGTGCGGTTGGTGCCCTTTTGGTCTATGACATCAGTAGGCGCCAGACTTTTGATAACGTTGACCGATGGCTTAACGAACTTCACACTCACTCAGATATGAACGTGGTCACAATACTTGTGGGCAACAAATCGGACCTAAAACATGCAAGAGAAGTTTCAACGGCGGAAGGGAAAACCTTGGCAGAGGCAGAGGGTCTTTTCTTCATGGAAACTTCAGCACTCGACTCTTCAAATGTAACTGCAGCTTTTCAAATGATTGTAAAAGAAATATTCAACATTTTGAGCCAGAAAGTTATTAAGTCCCAGGAGCTAAAGAAACAAGAACCCGACTTGAGCAATGGAAAGACTGTTGTTTTACAGGCTGATGATAAAAACCATGAAACACCAGCAGATGGGCAACCGAAGAAAGGTCCATGTTGTTCATCCTAG

Network for GWHGAAZE006465

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00071.23	Ras	11	171	2.40E-60

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K07904	RAB11A	Endocytosis	map04144
		Pancreatic secretion	map04972
		Vasopressin-regulated water reabsorption	map04962
		Endocrine and other factor-regulated calcium reabsorption	map04961

Gene Ontology

GO term	Ontology	Name
GO:0003924	molecular_function	GTPase activity
GO:0005525	molecular_function	GTP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	10.656
	SRR3591706	second leaf	4.906
	SRR3591707	mature leaf	1.706
	SRR3591708	Shoot apex	3.825
	SRR3591709	Stem	6.490
	SRR3591710	White floral bud	3.097
	SRR3591711	White flower	1.194
	SRR3591712	Green floral bud	5.394
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	2.840
	SRR8316896	Juvenile bud stage	3.816
	SRR8316897	Juvenile bud stage	1.436
	SRR8316894	Third green stage	3.126
	SRR8316900	Third green stage	8.968
	SRR8316901	Third green stage	7.934
	SRR8316898	Complete white stage	0.064
	SRR8316899	Complete white stage	6.146
	SRR8316903	Complete white stage	0.198
	SRR8316902	Silver flowering stage	0.266
	SRR8316904	Silver flowering stage	0.687
	SRR8316905	Silver flowering stage	0.642
	SRR8316906	Gold flowering stage	0.695
	SRR8316907	Gold flowering stage	0.725
	SRR8316908	Gold flowering stage	0.632
SRP132670	SRR6706286	Control	4.846
	SRR6706287	Light intensity 50%	5.367
	SRR6706288	Light intensity 20%	4.552
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	11.401
	CNS0095593	Slightly white alabastrum(diploid) 2	14.647
	CNS0095594	Slightly white alabastrum(diploid) 3	11.134
	CNS0095595	Whole white alabastrum(diploid) 2	5.264
	CNS0095596	Whole white alabastrum(diploid) 3	9.634
	CNS0095597	Whole white alabastrum(diploid) 4	6.073
	CNS0095598	Silvery flower (diploied) 1	1.108
	CNS0095599	Silvery flower (diploied) 2	1.112
	CNS0095600	Silvery flower (diploied) 3	0.842
	CNS0095601	Golden flower (diploid) 1	0.681
	CNS0095602	Golden flower (diploid) 2	0.279
	CNS0095603	Golden flower (diploid) 3	0.623
	CNS0095604	Slightly white alabastrum(tetraploid) 1	10.650
	CNS0095605	Slightly white alabastrum(tetraploid) 2	10.492
	CNS0095606	Slightly white alabastrum(tetraploid) 3	10.187
	CNS0095607	Whole white alabastrum(tetraploid) 1	6.758
	CNS0095608	Whole white alabastrum(tetraploid) 2	5.839
	CNS0095609	Whole white alabastrum(tetraploid) 3	5.174
	CNS0095610	Silvery flower (diploied) 1	0.404
	CNS0095611	Silvery flower (diploied) 2	0.098
	CNS0095612	Silvery flower (diploied) 3	0.611
	CNS0095613	Golden flower (tetraploid) 1	0.275
	CNS0095614	Golden flower (tetraploid) 2	0.078
	CNS0095615	Golden flower (tetraploid) 3	0.149
CRA001975	CRR073297	Stem 1	2.733
	CRR073298	Stem 2	3.198
	CRR073299	Stem 3	2.078
	CRR073300	Leaf 1	3.213
	CRR073301	Leaf 2	5.204
	CRR073302	Leaf 3	2.977
	CRR073303	Juvenile bud 1	2.664
	CRR073304	Juvenile bud 2	0.915
	CRR073305	Juvenile bud 3	2.048
	CRR073306	Third green 1	0.211
	CRR073307	Third green 2	0.395
	CRR073308	Third green 3	0.288
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.014
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.539
	CRR073316	Gold flowering 2	0.833
	CRR073317	Gold flowering 3	0.875
	CRR073318	Tawny withering 1	3.912
	CRR073319	Tawny withering 2	5.407
	CRR073320	Tawny withering 3	13.224