Gene detail

Detail information of GWHGAAZE006547

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP19906.1	4.32503E-64	unnamed protein product [Coffea canephora]
Swissprot	tr\|B9RXW0\|TPS7_RICCO	4E-56	Alpha-farnesene synthase
trEMBL	tr\|A0A068VGQ7\|A0A068VGQ7_COFCA	2E-64	Coffea canephora DH200=94 genomic scaffold, scaffold_774 {ECO:0000313\|EMBL:CDP19906.1}
TAIR10	AT3G25810.1	9E-32	Terpenoid cyclases/Protein prenyltransferases superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	27587510	27588167	+
GWHAAZE00000002	mRNA	27587510	27588167	+
GWHAAZE00000002	exon	27587510	27587779	+
GWHAAZE00000002	exon	27587877	27588167	+
GWHAAZE00000002	CDS	27587510	27587779	+
GWHAAZE00000002	CDS	27587877	27588167	+

Transcript Sequence
>GWHTAAZE006555 ATGATTTTGTTTCTGAAGTGGGCGGATTTTTGCAAAGCATTACTTGTGGAAGCAAGGTGGTACAACAAGGGTTATACACCATCCGTTCAAGAGTATCTTGAGAATGGGTGGATTTCTTCCTCCGGTCCTATTCTCTCTCTTTATGCATTATTATTCTTTGTTACAAACGAGATAGCAGAGGATCTCACAGATCTTCTCAAAATTACCAAGGATCTGGTGTATTATATGTCCCTCATTATTCGACTTTGCAATGACCAAGGAACTTCTGCGGCAGAACTAGAGAGAGGCGATTCTCCTTCGTCCATCGTGTGCTTTATGCAGGAAAACAATGTTACAGAGGAGGTGGCTCAAGAACACATCGGAAGATTAGTAGTAAGTGCGTGGAAGAAAATGAACAAACTCGGCATTAACCAATCTCTAGTGTTGAGAGAATTTGTCAAATGTACAATAAATATAGCGCGAGTGGCACAATTTATTTACCACAAGAGAGATGGGTTTGGGGTTCAAGACCCCGGGACAAAACATCATGTTGTGGCTTTGTTGGTTGAACCTCTTACATGA

Network for GWHGAAZE006547

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03936.17	Terpene_synth_C	6	130	9.60E-33

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K14173	AFS1	Biosynthesis of secondary metabolites	map01110
K14173	AFS1	Sesquiterpenoid and triterpenoid biosynthesis	map00909

Gene Ontology

GO term	Ontology	Name
GO:0000287	molecular_function	magnesium ion binding
GO:0010333	molecular_function	terpene synthase activity
GO:0016829	molecular_function	lyase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	7.147
	SRR3591706	second leaf	0.950
	SRR3591707	mature leaf	0.685
	SRR3591708	Shoot apex	5.138
	SRR3591709	Stem	5.758
	SRR3591710	White floral bud	0.078
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.527
	SRR3591713	Yellow flower	0.231
SRP173429	SRR8316895	Juvenile bud stage	0.172
	SRR8316896	Juvenile bud stage	0.348
	SRR8316897	Juvenile bud stage	0.317
	SRR8316894	Third green stage	0.235
	SRR8316900	Third green stage	0.325
	SRR8316901	Third green stage	0.279
	SRR8316898	Complete white stage	0.006
	SRR8316899	Complete white stage	1.057
	SRR8316903	Complete white stage	0.007
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.116
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.142
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.351
SRP132670	SRR6706286	Control	0.090
	SRR6706287	Light intensity 50%	0.194
	SRR6706288	Light intensity 20%	0.271
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.576
	CNS0095593	Slightly white alabastrum(diploid) 2	1.320
	CNS0095594	Slightly white alabastrum(diploid) 3	0.261
	CNS0095595	Whole white alabastrum(diploid) 2	0.701
	CNS0095596	Whole white alabastrum(diploid) 3	0.131
	CNS0095597	Whole white alabastrum(diploid) 4	0.154
	CNS0095598	Silvery flower (diploied) 1	0.703
	CNS0095599	Silvery flower (diploied) 2	0.478
	CNS0095600	Silvery flower (diploied) 3	0.245
	CNS0095601	Golden flower (diploid) 1	0.249
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.076
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.009
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.306
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.890
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.098
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.079
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (diploied) 1	0.110
	CNS0095611	Silvery flower (diploied) 2	0.000
	CNS0095612	Silvery flower (diploied) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.117
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.063
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.281
	CRR073299	Stem 3	0.075
	CRR073300	Leaf 1	0.331
	CRR073301	Leaf 2	0.155
	CRR073302	Leaf 3	0.155
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.004
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.001
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.014
	CRR073316	Gold flowering 2	0.007
	CRR073317	Gold flowering 3	0.405
	CRR073318	Tawny withering 1	0.198
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.094