Gene detail

Detail information of GWHGAAZE006560

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ADG96406.1	8.41355E-46	S-locus receptor kinase-like protein, partial [Olea europaea]
Swissprot	tr\|Q39086\|SD17_ARATH	1E-40	Receptor-like serine/threonine-protein kinase SD1-7 (Precursor)
trEMBL	tr\|D7RJY7\|D7RJY7_OLEEU	3E-46	S-locus receptor kinase-like protein {ECO:0000313\|EMBL:ADG96406.1} (Fragment)
TAIR10	AT1G65790.1	2E-35	receptor kinase 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	27749013	27749362	-
GWHAAZE00000002	mRNA	27749013	27749362	-
GWHAAZE00000002	exon	27749013	27749181	-
GWHAAZE00000002	exon	27749274	27749362	-
GWHAAZE00000002	CDS	27749274	27749362	-
GWHAAZE00000002	CDS	27749013	27749181	-

Transcript Sequence
>GWHTAAZE006568 ATGAATCCCAAGATATCAGACTTTGGCATGGCAAGAATTTTCGGGAGAGATCAGACCGAAGCAAATACAAAGAGAGTAGTTGGAACATACGGTTATATGGCTCCAGAATATGCCATGGACGGTCTTTTCTCGGCAAAATCTGATGTTTTCAGCTTTGGGGTTTTAGTTTTGGAGATTGTGAGCGGTAAGAAGAACAGAGGATTCTACTACACGAATAATCAACAGAACCTTCTTGGACATGTAAGTTTGAGTATCTAG

Network for GWHGAAZE006560

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF07714.18	PK_Tyr_Ser-Thr	4	65	1.10E-14

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_DLSV

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	10.785
	SRR3591706	second leaf	7.587
	SRR3591707	mature leaf	3.620
	SRR3591708	Shoot apex	17.304
	SRR3591709	Stem	6.505
	SRR3591710	White floral bud	3.862
	SRR3591711	White flower	7.045
	SRR3591712	Green floral bud	1.855
	SRR3591713	Yellow flower	9.524
SRP173429	SRR8316895	Juvenile bud stage	4.401
	SRR8316896	Juvenile bud stage	7.362
	SRR8316897	Juvenile bud stage	2.171
	SRR8316894	Third green stage	1.608
	SRR8316900	Third green stage	1.280
	SRR8316901	Third green stage	1.907
	SRR8316898	Complete white stage	0.727
	SRR8316899	Complete white stage	1.463
	SRR8316903	Complete white stage	1.190
	SRR8316902	Silver flowering stage	1.265
	SRR8316904	Silver flowering stage	3.142
	SRR8316905	Silver flowering stage	0.622
	SRR8316906	Gold flowering stage	4.547
	SRR8316907	Gold flowering stage	4.212
	SRR8316908	Gold flowering stage	4.421
SRP132670	SRR6706286	Control	0.255
	SRR6706287	Light intensity 50%	0.266
	SRR6706288	Light intensity 20%	0.516
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.444
	CNS0095593	Slightly white alabastrum(diploid) 2	2.920
	CNS0095594	Slightly white alabastrum(diploid) 3	4.581
	CNS0095595	Whole white alabastrum(diploid) 2	1.830
	CNS0095596	Whole white alabastrum(diploid) 3	1.922
	CNS0095597	Whole white alabastrum(diploid) 4	0.787
	CNS0095598	Silvery flower (diploied) 1	1.029
	CNS0095599	Silvery flower (diploied) 2	1.154
	CNS0095600	Silvery flower (diploied) 3	4.133
	CNS0095601	Golden flower (diploid) 1	3.854
	CNS0095602	Golden flower (diploid) 2	3.045
	CNS0095603	Golden flower (diploid) 3	2.123
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.138
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.306
	CNS0095606	Slightly white alabastrum(tetraploid) 3	5.153
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.351
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.306
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.714
	CNS0095610	Silvery flower (diploied) 1	1.525
	CNS0095611	Silvery flower (diploied) 2	1.684
	CNS0095612	Silvery flower (diploied) 3	6.434
	CNS0095613	Golden flower (tetraploid) 1	3.937
	CNS0095614	Golden flower (tetraploid) 2	6.063
	CNS0095615	Golden flower (tetraploid) 3	4.290
CRA001975	CRR073297	Stem 1	1.643
	CRR073298	Stem 2	2.314
	CRR073299	Stem 3	0.458
	CRR073300	Leaf 1	1.153
	CRR073301	Leaf 2	0.492
	CRR073302	Leaf 3	0.050
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.171
	CRR073305	Juvenile bud 3	0.814
	CRR073306	Third green 1	0.341
	CRR073307	Third green 2	1.750
	CRR073308	Third green 3	0.536
	CRR073309	Second white 1	0.688
	CRR073310	Second white 2	0.860
	CRR073311	Second white 3	0.608
	CRR073312	Silver flowering 1	1.423
	CRR073313	Silver flowering 2	1.142
	CRR073314	Silver flowering 3	0.323
	CRR073315	Gold flowering 1	1.086
	CRR073316	Gold flowering 2	1.391
	CRR073317	Gold flowering 3	0.153
	CRR073318	Tawny withering 1	1.114
	CRR073319	Tawny withering 2	3.128
	CRR073320	Tawny withering 3	2.094