Gene detail

Detail information of GWHGAAZE006807

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007041095.1	3.4075E-159	Tyrosine/DOPA decarboxylase [Theobroma cacao]
Swissprot	tr\|P54770\|TYDC3_PAPSO	6E-160	Tyrosine decarboxylase
trEMBL	tr\|A0A061DXW3\|A0A061DXW3_THECC	1E-159	Tyrosine/DOPA decarboxylase {ECO:0000313\|EMBL:EOX96926.1}
TAIR10	AT2G20340.1	2E-100	Pyridoxal phosphate (PLP)-dependent transferases superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	32417107	32418132	+
GWHAAZE00000002	mRNA	32417107	32418132	+
GWHAAZE00000002	exon	32417107	32417690	+
GWHAAZE00000002	exon	32417832	32418132	+
GWHAAZE00000002	CDS	32417107	32417690	+
GWHAAZE00000002	CDS	32417832	32418132	+

Transcript Sequence
>GWHTAAZE006815 ATGAACCCACTTGATCCAAAAGAACTAAGGAGGCAAGGCCATATTCTAGTAGATTTTATAGCTGATTATTACCAAAATATCGAAAAATACCCAGCTCTCAGCCAAGTAGAACCTGGTTATCTCCGGCAACTCTTGCCAGACTCAGCTCCAGTCAAGTCCGAGTCCATTGAAAAAATCCTCAAAGATGTACAAACCAATATCATCCCTGGTTTAACTCACTGGCAAAGCCCTAATTTCTTCGCATATTTTCAGTCAAATGGAAGTGTCGCGAATTTCCTAGGTGAAATGTTGTGCACGGGTTTCAATGTTGTCGGATTTAATTGGATTTCCTCTCCAGCAGCAACTGAATTAGAAAGCATAGTCATGGATTGGTTGGCTAAATTGCTTGAGCTACCAAAATCTTACCAATTTGGTGGTGGTGGTGGTGGTGGTGGTGTCATACACGGGTCCACTTGTGAGGCATTTGTGTGTACACTAACTGCTGCTAGAGAAGAAATGTTGAACAAAATTGGTAGGGAAAATATGGGGAAGCTTGTTGTATACGCATCTGATCAAACACATTTCTCTCTCCAAAAAGCGGCGAATATCGGTACTACCTCCTCAGGAGCTGCAGACCCGTTGGGCCCGTTATGCGAGGTGGCAAATAAGTACAACATGTGGGTCCACATTGACGCAGCTTACGCGGGGAGCGCATGTATTTGCCCGGAATTCCGCCACTTTCTTAACGGGGTCGAGCTCGCTAATTCGTTTAGTCTGAACGCACATAAATGGTTCTTGACCACTCTTGATTGTTGTTGCTTATGGGTAAAAGACCCGAAAGCGCTTATCAAGGCGCTTTCGACTAATCCCGAGCTCTTGTCAAACAAAGTTACAGAGTCTAATTAA

Network for GWHGAAZE006807

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00282.20	Pyridoxal_deC	38	196	1.00E-40

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01593	DDC, TDC	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Tyrosine metabolism	map00350
		Phenylalanine metabolism	map00360
		Tryptophan metabolism	map00380
		Indole alkaloid biosynthesis	map00901
		Isoquinoline alkaloid biosynthesis	map00950
		Betalain biosynthesis	map00965
		Dopaminergic synapse	map04728
		Serotonergic synapse	map04726
		Axon regeneration	map04361

Gene Ontology

GO term	Ontology	Name
GO:0019752	biological_process	carboxylic acid metabolic process
GO:0006520	biological_process	cellular amino acid metabolic process
GO:0016831	molecular_function	carboxy-lyase activity
GO:0030170	molecular_function	pyridoxal phosphate binding
GO:0003824	molecular_function	catalytic activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.192
	SRR3591706	second leaf	0.077
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	58.300
	SRR3591711	White flower	353.682
	SRR3591712	Green floral bud	0.120
	SRR3591713	Yellow flower	349.338
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.182
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.326
	SRR8316901	Third green stage	0.286
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.022
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.299
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.201
	SRR6706287	Light intensity 50%	0.321
	SRR6706288	Light intensity 20%	0.237
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (diploied) 1	0.000
	CNS0095611	Silvery flower (diploied) 2	0.000
	CNS0095612	Silvery flower (diploied) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.065
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.016
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.002
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.050
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.012
	CRR073320	Tawny withering 3	0.000