Gene detail

Detail information of GWHGAAZE007265

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CAN63122.1	2.19192E-94	hypothetical protein VITISV_010765 [Vitis vinifera]
Swissprot	tr\|Q9FF66\|UBC22_ARATH	3E-83	Ubiquitin-conjugating enzyme E2 22
trEMBL	tr\|A5B472\|A5B472_VITVI	8E-95	Putative uncharacterized protein {ECO:0000313\|EMBL:CAN63122.1}
TAIR10	AT5G05080.2	3E-67	ubiquitin-conjugating enzyme 22

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	41604943	41608526	+
GWHAAZE00000002	mRNA	41604943	41608526	+
GWHAAZE00000002	exon	41604943	41604988	+
GWHAAZE00000002	exon	41606788	41606900	+
GWHAAZE00000002	exon	41607045	41607148	+
GWHAAZE00000002	exon	41608187	41608526	+
GWHAAZE00000002	CDS	41604943	41604988	+
GWHAAZE00000002	CDS	41606788	41606900	+
GWHAAZE00000002	CDS	41607045	41607148	+
GWHAAZE00000002	CDS	41608187	41608526	+

Transcript Sequence
>GWHTAAZE007273 ATGAAGTTGATACTCTCTCATGACTTCCCACATTCCCCTCCCAAAGGTTACTTTCTCACCAAGATTTTCCATCCTAACATTGCAACCAATGGTGAGATTTGTGTCAACACGTTGAAGAAAGATTGGAACCCGAGCCTTGGCTTACGGCATGTTCTAATTGTAGTGAGATGTTTACTGATTGAACCATTCCCAGAATCAGCTCTAAACGAGCAAGCTGGCAAAATGTTGCTTGAAAATTATGAGGAGTATGCCAGGCATGCCAGGCTTTATACCGGAATTCATGCACTCAAGCTGAAGCCGAAGTTCAAAACGGGAGCAATTTGCGAGTCAACTACCACCATAAACGTAGAGCAGACGACGAATTCCTTGGTTATTAACGTTGACCATAAGAACGCAGCAGTATCAGGTGGTGGTGCTGGACCCCACCTGACATCTCTGCTGGCTCCTTCCAACACCTTGAAAGAAATTAATGGGTCCACTGCAGCAACTCCAGTAATTACTGCGCTAAAGAAGGAAGGCAGCAGCATTGGTGGTGGGTTGGCAAAAGTACCAGCGGACAAGAAGAAGATGGATGCAAGAAAGAAAAGCTTGAAAAGATTATGA

Network for GWHGAAZE007265

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00179.27	UQ_con	3	90	1.20E-24

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	UBC

KEGG pathway

KO	Enzyme	pathway	mapID
K10583	UBE2S, E2EPF	Ubiquitin mediated proteolysis	map04120

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	109.211
	SRR3591706	second leaf	26.772
	SRR3591707	mature leaf	24.869
	SRR3591708	Shoot apex	94.425
	SRR3591709	Stem	74.813
	SRR3591710	White floral bud	52.241
	SRR3591711	White flower	49.984
	SRR3591712	Green floral bud	60.053
	SRR3591713	Yellow flower	45.179
SRP173429	SRR8316895	Juvenile bud stage	36.521
	SRR8316896	Juvenile bud stage	54.265
	SRR8316897	Juvenile bud stage	34.949
	SRR8316894	Third green stage	22.040
	SRR8316900	Third green stage	52.091
	SRR8316901	Third green stage	47.978
	SRR8316898	Complete white stage	23.881
	SRR8316899	Complete white stage	94.517
	SRR8316903	Complete white stage	34.251
	SRR8316902	Silver flowering stage	20.162
	SRR8316904	Silver flowering stage	25.756
	SRR8316905	Silver flowering stage	13.827
	SRR8316906	Gold flowering stage	39.782
	SRR8316907	Gold flowering stage	41.119
	SRR8316908	Gold flowering stage	41.904
SRP132670	SRR6706286	Control	67.148
	SRR6706287	Light intensity 50%	63.623
	SRR6706288	Light intensity 20%	67.730
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	56.893
	CNS0095593	Slightly white alabastrum(diploid) 2	53.733
	CNS0095594	Slightly white alabastrum(diploid) 3	61.587
	CNS0095595	Whole white alabastrum(diploid) 2	50.540
	CNS0095596	Whole white alabastrum(diploid) 3	31.589
	CNS0095597	Whole white alabastrum(diploid) 4	44.068
	CNS0095598	Silvery flower (diploied) 1	50.693
	CNS0095599	Silvery flower (diploied) 2	52.994
	CNS0095600	Silvery flower (diploied) 3	46.476
	CNS0095601	Golden flower (diploid) 1	45.652
	CNS0095602	Golden flower (diploid) 2	46.908
	CNS0095603	Golden flower (diploid) 3	47.320
	CNS0095604	Slightly white alabastrum(tetraploid) 1	48.233
	CNS0095605	Slightly white alabastrum(tetraploid) 2	47.434
	CNS0095606	Slightly white alabastrum(tetraploid) 3	66.707
	CNS0095607	Whole white alabastrum(tetraploid) 1	47.960
	CNS0095608	Whole white alabastrum(tetraploid) 2	39.496
	CNS0095609	Whole white alabastrum(tetraploid) 3	36.779
	CNS0095610	Silvery flower (diploied) 1	39.228
	CNS0095611	Silvery flower (diploied) 2	56.315
	CNS0095612	Silvery flower (diploied) 3	31.222
	CNS0095613	Golden flower (tetraploid) 1	32.558
	CNS0095614	Golden flower (tetraploid) 2	39.216
	CNS0095615	Golden flower (tetraploid) 3	39.794
CRA001975	CRR073297	Stem 1	62.135
	CRR073298	Stem 2	51.175
	CRR073299	Stem 3	59.819
	CRR073300	Leaf 1	55.298
	CRR073301	Leaf 2	59.537
	CRR073302	Leaf 3	52.944
	CRR073303	Juvenile bud 1	69.358
	CRR073304	Juvenile bud 2	58.327
	CRR073305	Juvenile bud 3	73.967
	CRR073306	Third green 1	29.864
	CRR073307	Third green 2	30.335
	CRR073308	Third green 3	34.658
	CRR073309	Second white 1	23.158
	CRR073310	Second white 2	26.185
	CRR073311	Second white 3	21.966
	CRR073312	Silver flowering 1	19.504
	CRR073313	Silver flowering 2	17.983
	CRR073314	Silver flowering 3	18.842
	CRR073315	Gold flowering 1	24.028
	CRR073316	Gold flowering 2	30.508
	CRR073317	Gold flowering 3	14.072
	CRR073318	Tawny withering 1	83.996
	CRR073319	Tawny withering 2	88.977
	CRR073320	Tawny withering 3	98.800