Gene detail

Detail information of GWHGAAZE007335

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009628802.1	1.95791E-53	PREDICTED: probable calcium-binding protein CML18 [Nicotiana tomentosiformis]
Swissprot	tr\|Q9LE22\|CML27_ARATH	1E-39	Probable calcium-binding protein CML27
trEMBL	tr\|M1D0I1\|M1D0I1_SOLTU	2E-53	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400078654}
TAIR10	AT1G18210.2	3E-32	Calcium-binding EF-hand family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	43422819	43423226	-
GWHAAZE00000002	mRNA	43422819	43423226	-
GWHAAZE00000002	exon	43423116	43423226	-
GWHAAZE00000002	exon	43422819	43423067	-
GWHAAZE00000002	CDS	43423116	43423226	-
GWHAAZE00000002	CDS	43422819	43423067	-

Transcript Sequence
>GWHTAAZE007343 ATGGTGTTCCGAAAGTTCGACGCCAACGGCGACGGCAAGATCTCGCTGACGGAGCTCGGAGCGATTCTCCGAGCACTCGGCTCTGATACGTCCGAATCGGAGCTGAAGCGCGAGTTCACCGAATTCCACCGAGGATCCAACGGCGGTGCGAGCGGCAATCAGGAGCTTCGTGAGGCGTTCGATCTGTACGACAGGGACAAGAACGGATCGATCTCGGCTAGCGAGTTGCACGCGGTGTTAAAGAGCTTGGGGGAGAAGTGTACGTTGAAGGATTGCCGGAAGATGATTAGCTCTGTGGATGTGGATGGTGATGGTTGCGTTAATTTTGAGGAGTTCAAGAAGATGATGAACAAGTCTTAA

Network for GWHGAAZE007335

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13202.7	EF-hand_5	2	22	1.80E-07
PF13499.7	EF-hand_7	54	116	1.10E-14

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13448	CML	Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0005509	molecular_function	calcium ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	399.533
	SRR3591706	second leaf	124.088
	SRR3591707	mature leaf	63.562
	SRR3591708	Shoot apex	351.805
	SRR3591709	Stem	416.722
	SRR3591710	White floral bud	188.694
	SRR3591711	White flower	256.182
	SRR3591712	Green floral bud	184.762
	SRR3591713	Yellow flower	145.327
SRP173429	SRR8316895	Juvenile bud stage	300.540
	SRR8316896	Juvenile bud stage	333.306
	SRR8316897	Juvenile bud stage	189.691
	SRR8316894	Third green stage	61.272
	SRR8316900	Third green stage	122.282
	SRR8316901	Third green stage	197.030
	SRR8316898	Complete white stage	11.853
	SRR8316899	Complete white stage	420.271
	SRR8316903	Complete white stage	17.856
	SRR8316902	Silver flowering stage	16.641
	SRR8316904	Silver flowering stage	14.673
	SRR8316905	Silver flowering stage	17.736
	SRR8316906	Gold flowering stage	85.910
	SRR8316907	Gold flowering stage	53.664
	SRR8316908	Gold flowering stage	53.377
SRP132670	SRR6706286	Control	65.839
	SRR6706287	Light intensity 50%	78.624
	SRR6706288	Light intensity 20%	69.511
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	214.771
	CNS0095593	Slightly white alabastrum(diploid) 2	327.072
	CNS0095594	Slightly white alabastrum(diploid) 3	266.180
	CNS0095595	Whole white alabastrum(diploid) 2	190.428
	CNS0095596	Whole white alabastrum(diploid) 3	52.927
	CNS0095597	Whole white alabastrum(diploid) 4	172.516
	CNS0095598	Silvery flower (diploied) 1	388.168
	CNS0095599	Silvery flower (diploied) 2	299.648
	CNS0095600	Silvery flower (diploied) 3	137.935
	CNS0095601	Golden flower (diploid) 1	365.827
	CNS0095602	Golden flower (diploid) 2	204.181
	CNS0095603	Golden flower (diploid) 3	200.946
	CNS0095604	Slightly white alabastrum(tetraploid) 1	14.777
	CNS0095605	Slightly white alabastrum(tetraploid) 2	14.235
	CNS0095606	Slightly white alabastrum(tetraploid) 3	25.785
	CNS0095607	Whole white alabastrum(tetraploid) 1	11.355
	CNS0095608	Whole white alabastrum(tetraploid) 2	7.097
	CNS0095609	Whole white alabastrum(tetraploid) 3	9.133
	CNS0095610	Silvery flower (diploied) 1	23.810
	CNS0095611	Silvery flower (diploied) 2	9.502
	CNS0095612	Silvery flower (diploied) 3	101.667
	CNS0095613	Golden flower (tetraploid) 1	28.516
	CNS0095614	Golden flower (tetraploid) 2	17.073
	CNS0095615	Golden flower (tetraploid) 3	15.526
CRA001975	CRR073297	Stem 1	305.929
	CRR073298	Stem 2	303.017
	CRR073299	Stem 3	430.503
	CRR073300	Leaf 1	407.949
	CRR073301	Leaf 2	606.621
	CRR073302	Leaf 3	409.637
	CRR073303	Juvenile bud 1	414.009
	CRR073304	Juvenile bud 2	471.272
	CRR073305	Juvenile bud 3	422.764
	CRR073306	Third green 1	337.731
	CRR073307	Third green 2	503.851
	CRR073308	Third green 3	347.740
	CRR073309	Second white 1	432.532
	CRR073310	Second white 2	496.866
	CRR073311	Second white 3	372.940
	CRR073312	Silver flowering 1	725.267
	CRR073313	Silver flowering 2	821.626
	CRR073314	Silver flowering 3	634.395
	CRR073315	Gold flowering 1	593.141
	CRR073316	Gold flowering 2	359.115
	CRR073317	Gold flowering 3	414.873
	CRR073318	Tawny withering 1	505.162
	CRR073319	Tawny withering 2	439.169
	CRR073320	Tawny withering 3	760.969