Gene detail

Detail information of GWHGAAZE007683

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009791965.1	4.14677E-27	PREDICTED: serine/threonine-protein kinase/endoribonuclease IRE1a [Nicotiana sylvestris]
Swissprot	tr\|Q93VJ2\|IRE1B_ARATH	3E-13	Endoribonuclease (Precursor)
trEMBL	tr\|A0A068TZS7\|A0A068TZS7_COFCA	2E-26	Coffea canephora DH200=94 genomic scaffold, scaffold_7 {ECO:0000313\|EMBL:CDP01775.1}
TAIR10	AT5G24360.2	0.00000002	inositol requiring 1-1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	50151488	50154598	-
GWHAAZE00000002	mRNA	50151488	50154598	-
GWHAAZE00000002	exon	50151488	50151520	-
GWHAAZE00000002	exon	50151695	50151923	-
GWHAAZE00000002	exon	50154192	50154312	-
GWHAAZE00000002	exon	50154586	50154598	-
GWHAAZE00000002	CDS	50154586	50154598	-
GWHAAZE00000002	CDS	50154192	50154312	-
GWHAAZE00000002	CDS	50151695	50151923	-
GWHAAZE00000002	CDS	50151488	50151520	-

Transcript Sequence
>GWHTAAZE007691 ATGAAGCTACGAGGCTTGTTTGGTGCTGTCCACAACTCTCAGGTATCGAAAATATCATATACGACTCTGTTGGGCAACGGTTTGGCTGTGATTGATCGACCACCGGCGAGACGGTCTCTCTTGTCAGATGCTAATGAACATGATACTGCGCTAGTTGCTACACTGGATGGAACAATCAATCTACTGGACCTTAAATCTGGTAAAACCCTGTGGTCGTTTGCATCAGGATCATCAATTTATTCTTCGTATCAGGCTCCTGTCAACCACGGTGGTGATGAGGAAAATGCCTCTGATGGAGCTGGTTATTTTATAGATTGTGGGGATGACTGGAAGTTGTATGCTGATAATGGGCTACGCAAAATGGTGTGTTGTGGTCCATTTGGTAGGAGGATGTGA

Network for GWHGAAZE007683

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01011.22	PQQ	50	83	0.00021

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08852	ERN1	Protein processing in endoplasmic reticulum	map04141
		Autophagy - animal	map04140
		Apoptosis	map04210

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	11.872
	SRR3591706	second leaf	7.276
	SRR3591707	mature leaf	7.036
	SRR3591708	Shoot apex	6.200
	SRR3591709	Stem	9.930
	SRR3591710	White floral bud	7.871
	SRR3591711	White flower	10.814
	SRR3591712	Green floral bud	7.180
	SRR3591713	Yellow flower	5.898
SRP173429	SRR8316895	Juvenile bud stage	3.248
	SRR8316896	Juvenile bud stage	3.771
	SRR8316897	Juvenile bud stage	1.839
	SRR8316894	Third green stage	2.621
	SRR8316900	Third green stage	4.392
	SRR8316901	Third green stage	7.125
	SRR8316898	Complete white stage	2.141
	SRR8316899	Complete white stage	4.672
	SRR8316903	Complete white stage	6.515
	SRR8316902	Silver flowering stage	2.092
	SRR8316904	Silver flowering stage	5.395
	SRR8316905	Silver flowering stage	3.240
	SRR8316906	Gold flowering stage	12.459
	SRR8316907	Gold flowering stage	6.924
	SRR8316908	Gold flowering stage	12.398
SRP132670	SRR6706286	Control	4.737
	SRR6706287	Light intensity 50%	4.284
	SRR6706288	Light intensity 20%	4.246
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.885
	CNS0095593	Slightly white alabastrum(diploid) 2	0.666
	CNS0095594	Slightly white alabastrum(diploid) 3	0.576
	CNS0095595	Whole white alabastrum(diploid) 2	2.241
	CNS0095596	Whole white alabastrum(diploid) 3	0.376
	CNS0095597	Whole white alabastrum(diploid) 4	0.474
	CNS0095598	Silvery flower (diploied) 1	4.732
	CNS0095599	Silvery flower (diploied) 2	4.506
	CNS0095600	Silvery flower (diploied) 3	8.153
	CNS0095601	Golden flower (diploid) 1	2.807
	CNS0095602	Golden flower (diploid) 2	8.147
	CNS0095603	Golden flower (diploid) 3	7.186
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.553
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.916
	CNS0095606	Slightly white alabastrum(tetraploid) 3	10.001
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.100
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.406
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.325
	CNS0095610	Silvery flower (diploied) 1	6.540
	CNS0095611	Silvery flower (diploied) 2	7.576
	CNS0095612	Silvery flower (diploied) 3	6.537
	CNS0095613	Golden flower (tetraploid) 1	3.378
	CNS0095614	Golden flower (tetraploid) 2	3.547
	CNS0095615	Golden flower (tetraploid) 3	6.385
CRA001975	CRR073297	Stem 1	9.389
	CRR073298	Stem 2	4.034
	CRR073299	Stem 3	4.363
	CRR073300	Leaf 1	4.682
	CRR073301	Leaf 2	4.578
	CRR073302	Leaf 3	5.403
	CRR073303	Juvenile bud 1	3.329
	CRR073304	Juvenile bud 2	1.623
	CRR073305	Juvenile bud 3	3.327
	CRR073306	Third green 1	2.545
	CRR073307	Third green 2	1.875
	CRR073308	Third green 3	3.072
	CRR073309	Second white 1	1.241
	CRR073310	Second white 2	2.196
	CRR073311	Second white 3	4.209
	CRR073312	Silver flowering 1	2.253
	CRR073313	Silver flowering 2	2.335
	CRR073314	Silver flowering 3	4.650
	CRR073315	Gold flowering 1	0.936
	CRR073316	Gold flowering 2	4.297
	CRR073317	Gold flowering 3	0.848
	CRR073318	Tawny withering 1	4.342
	CRR073319	Tawny withering 2	2.953
	CRR073320	Tawny withering 3	3.302