Gene detail

Detail information of GWHGAAZE007875

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010269485.1	5.86251E-25	PREDICTED: mitogen-activated protein kinase kinase kinase NPK1-like [Nelumbo nucifera]
Swissprot	tr\|Q9CAD5\|YODA_ARATH	3E-19	Mitogen-activated protein kinase kinase kinase YODA
trEMBL	tr\|A0A059AM93\|A0A059AM93_EUCGR	4E-25	Uncharacterized protein {ECO:0000313\|EMBL:KCW54938.1}
TAIR10	AT1G07150.1	7E-21	mitogen-activated protein kinase kinase kinase 13

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	54998313	54998675	-
GWHAAZE00000002	mRNA	54998313	54998675	-
GWHAAZE00000002	exon	54998313	54998675	-
GWHAAZE00000002	CDS	54998313	54998675	-

Transcript Sequence
>GWHTAAZE007883 ATGCTGCTTGAGAAATATGAGGCGCCAATGGATATATGGGCTTTGGGGTGCAGTATAATCGAGATGGTGACAGGGAAGCCCATGTGGCGTGCTAGAAATATAGAAGATCTGAAGCATCAAATTACTTCGGAGGAAGTCCCGGACATGCCAGCGCAGATGTCGGAACAGGGGAGAGATTTTTTAAGGAGGTGTTTGGATAGGAATCCGGCCAAAAGGTGGACGGCCAAGATGCTTTTGAGCCATCCCTTCATTACTATCAGTGACTTTGCCACCATTGATGAGGGCAGAAATTTATTGGTTTATGAAATTCCCCTAGGGTTTGGATGGGTTTCGAGTCTCTCCTTGTTTTCGGTTAATTGCTGA

Network for GWHGAAZE007875

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	5	84	4.30E-16

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	STE_STE11

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.031
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.142
	SRR3591710	White floral bud	1.263
	SRR3591711	White flower	1.554
	SRR3591712	Green floral bud	0.357
	SRR3591713	Yellow flower	0.583
SRP173429	SRR8316895	Juvenile bud stage	0.751
	SRR8316896	Juvenile bud stage	1.196
	SRR8316897	Juvenile bud stage	0.413
	SRR8316894	Third green stage	0.093
	SRR8316900	Third green stage	1.546
	SRR8316901	Third green stage	1.351
	SRR8316898	Complete white stage	1.939
	SRR8316899	Complete white stage	0.756
	SRR8316903	Complete white stage	1.381
	SRR8316902	Silver flowering stage	1.856
	SRR8316904	Silver flowering stage	2.819
	SRR8316905	Silver flowering stage	0.942
	SRR8316906	Gold flowering stage	0.877
	SRR8316907	Gold flowering stage	2.834
	SRR8316908	Gold flowering stage	1.912
SRP132670	SRR6706286	Control	0.864
	SRR6706287	Light intensity 50%	1.393
	SRR6706288	Light intensity 20%	0.785
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.893
	CNS0095593	Slightly white alabastrum(diploid) 2	0.148
	CNS0095594	Slightly white alabastrum(diploid) 3	0.934
	CNS0095595	Whole white alabastrum(diploid) 2	0.668
	CNS0095596	Whole white alabastrum(diploid) 3	0.763
	CNS0095597	Whole white alabastrum(diploid) 4	0.115
	CNS0095598	Silvery flower (diploied) 1	1.603
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	3.841
	CNS0095601	Golden flower (diploid) 1	0.428
	CNS0095602	Golden flower (diploid) 2	2.026
	CNS0095603	Golden flower (diploid) 3	1.493
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.049
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.643
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.591
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.942
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.308
	CNS0095609	Whole white alabastrum(tetraploid) 3	3.557
	CNS0095610	Silvery flower (diploied) 1	8.283
	CNS0095611	Silvery flower (diploied) 2	7.052
	CNS0095612	Silvery flower (diploied) 3	4.552
	CNS0095613	Golden flower (tetraploid) 1	3.103
	CNS0095614	Golden flower (tetraploid) 2	5.749
	CNS0095615	Golden flower (tetraploid) 3	4.778
CRA001975	CRR073297	Stem 1	0.726
	CRR073298	Stem 2	1.347
	CRR073299	Stem 3	0.073
	CRR073300	Leaf 1	0.490
	CRR073301	Leaf 2	0.652
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.163
	CRR073307	Third green 2	0.651
	CRR073308	Third green 3	0.970
	CRR073309	Second white 1	0.104
	CRR073310	Second white 2	0.271
	CRR073311	Second white 3	0.167
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.144
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.970
	CRR073320	Tawny withering 3	0.000