Gene detail

Detail information of GWHGAAZE008074

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KHG23422.1	1.63632E-85	Photosystem I reaction center subunit N, chloroplastic -like protein [Gossypium arboreum]
Swissprot	tr\|P49107\|PSAN_ARATH	6E-78	Photosystem I reaction center subunit N, chloroplastic (Precursor)
trEMBL	tr\|B9HES1\|B9HES1_POPTR	4E-80	Uncharacterized protein {ECO:0000313\|EMBL:EEE90365.1}
TAIR10	AT5G64040.1	1E-56	photosystem I reaction center subunit PSI-N, chloroplast, putative / PSI-N, putative (PSAN)

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	60723271	60724832	+
GWHAAZE00000002	mRNA	60723271	60724832	+
GWHAAZE00000002	exon	60723271	60723564	+
GWHAAZE00000002	exon	60723756	60723881	+
GWHAAZE00000002	exon	60724743	60724832	+
GWHAAZE00000002	CDS	60723271	60723564	+
GWHAAZE00000002	CDS	60723756	60723881	+
GWHAAZE00000002	CDS	60724743	60724832	+

Transcript Sequence
>GWHTAAZE008082 ATGGCAGCAATGAACTCTAGTGTGTTGGCATGTAACTATGCCGCCGTATCGGGTGCCGGGTCGTCAGAACTCAACTCAAAACTCGTTTCTACGCCTTCCGTTGTGTCCCCAATTAAGCAGATGCGTAAAATGCCTGTGATTAGAGCCCAAAATGTACGCCAAAATGATGGTAGCCAAGGAAGGAGGGCAGCCCTTCTTGGTCTTGGAGCTGCGCTTTTCGCCACTGTTGCGTCTAACTCTTCTGCGAATGCCGGGGTGTTCGACGAATATCTCGAGAAGAGCAAAGCTAACAAGGAATTGAATGACAAGAAGAGGTTGGTGACAAGTGGTGCAAACTTTTCAAGAGCATACACAGTTGAATTTGGGTCATGCACCTTCCCATATAACTTCACCGGCTGCCAAGATCTTGCCAAGCAAAAGAAAGTGCCATTTATTTCAGACGATTTGGAGTTGGAGTGCAAAGGAAAGGATAAATTCAAGTGTGGTTCCAATGTGTTCTGGAAATGGTGA

Network for GWHGAAZE008074

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF05479.12	PsaN	47	169	7.40E-64

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02701	psaN	Photosynthesis	map00195

Gene Ontology

GO term	Ontology	Name
GO:0015979	biological_process	photosynthesis
GO:0009522	cellular_component	photosystem I

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	768.392
	SRR3591706	second leaf	4071.351
	SRR3591707	mature leaf	2993.490
	SRR3591708	Shoot apex	1390.154
	SRR3591709	Stem	518.272
	SRR3591710	White floral bud	38.359
	SRR3591711	White flower	49.862
	SRR3591712	Green floral bud	27.917
	SRR3591713	Yellow flower	10.625
SRP173429	SRR8316895	Juvenile bud stage	205.209
	SRR8316896	Juvenile bud stage	156.058
	SRR8316897	Juvenile bud stage	133.772
	SRR8316894	Third green stage	58.692
	SRR8316900	Third green stage	91.728
	SRR8316901	Third green stage	90.922
	SRR8316898	Complete white stage	16.361
	SRR8316899	Complete white stage	58.100
	SRR8316903	Complete white stage	39.646
	SRR8316902	Silver flowering stage	14.524
	SRR8316904	Silver flowering stage	21.604
	SRR8316905	Silver flowering stage	2.623
	SRR8316906	Gold flowering stage	6.272
	SRR8316907	Gold flowering stage	13.097
	SRR8316908	Gold flowering stage	17.678
SRP132670	SRR6706286	Control	125.949
	SRR6706287	Light intensity 50%	81.180
	SRR6706288	Light intensity 20%	69.900
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	200.915
	CNS0095593	Slightly white alabastrum(diploid) 2	110.690
	CNS0095594	Slightly white alabastrum(diploid) 3	141.636
	CNS0095595	Whole white alabastrum(diploid) 2	71.515
	CNS0095596	Whole white alabastrum(diploid) 3	61.631
	CNS0095597	Whole white alabastrum(diploid) 4	55.131
	CNS0095598	Silvery flower (diploied) 1	336.827
	CNS0095599	Silvery flower (diploied) 2	316.165
	CNS0095600	Silvery flower (diploied) 3	74.746
	CNS0095601	Golden flower (diploid) 1	286.617
	CNS0095602	Golden flower (diploid) 2	177.435
	CNS0095603	Golden flower (diploid) 3	165.863
	CNS0095604	Slightly white alabastrum(tetraploid) 1	164.798
	CNS0095605	Slightly white alabastrum(tetraploid) 2	209.756
	CNS0095606	Slightly white alabastrum(tetraploid) 3	254.029
	CNS0095607	Whole white alabastrum(tetraploid) 1	88.482
	CNS0095608	Whole white alabastrum(tetraploid) 2	71.092
	CNS0095609	Whole white alabastrum(tetraploid) 3	80.619
	CNS0095610	Silvery flower (diploied) 1	67.349
	CNS0095611	Silvery flower (diploied) 2	95.198
	CNS0095612	Silvery flower (diploied) 3	20.851
	CNS0095613	Golden flower (tetraploid) 1	20.679
	CNS0095614	Golden flower (tetraploid) 2	68.105
	CNS0095615	Golden flower (tetraploid) 3	29.339
CRA001975	CRR073297	Stem 1	180.469
	CRR073298	Stem 2	170.887
	CRR073299	Stem 3	263.264
	CRR073300	Leaf 1	32.379
	CRR073301	Leaf 2	53.744
	CRR073302	Leaf 3	49.728
	CRR073303	Juvenile bud 1	32.916
	CRR073304	Juvenile bud 2	11.323
	CRR073305	Juvenile bud 3	49.687
	CRR073306	Third green 1	2.228
	CRR073307	Third green 2	4.886
	CRR073308	Third green 3	10.407
	CRR073309	Second white 1	0.279
	CRR073310	Second white 2	1.117
	CRR073311	Second white 3	0.576
	CRR073312	Silver flowering 1	0.509
	CRR073313	Silver flowering 2	0.673
	CRR073314	Silver flowering 3	3.705
	CRR073315	Gold flowering 1	1762.404
	CRR073316	Gold flowering 2	1421.420
	CRR073317	Gold flowering 3	1606.713
	CRR073318	Tawny withering 1	165.743
	CRR073319	Tawny withering 2	188.022
	CRR073320	Tawny withering 3	163.935