Gene detail

Detail information of GWHGAAZE008178

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDP20203.1	6.37072E-36	hypothetical protein JCGZ_07923 [Jatropha curcas]
Swissprot	tr\|P93184\|LOX21_HORVU	7E-33	Lipoxygenase 2.1, chloroplastic (Precursor)
trEMBL	tr\|A0A067JBW7\|A0A067JBW7_JATCU	2E-36	Lipoxygenase {ECO:0000256\|RuleBase:RU003975}
TAIR10	AT1G72520.1	5E-24	PLAT/LH2 domain-containing lipoxygenase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	64153084	64154056	-
GWHAAZE00000002	mRNA	64153084	64154056	-
GWHAAZE00000002	exon	64153084	64153145	-
GWHAAZE00000002	exon	64153332	64153568	-
GWHAAZE00000002	exon	64153897	64154056	-
GWHAAZE00000002	CDS	64153897	64154056	-
GWHAAZE00000002	CDS	64153332	64153568	-
GWHAAZE00000002	CDS	64153084	64153145	-

Transcript Sequence
>GWHTAAZE008186 ATGAACATGACAAAGAGATGTATCTCTACAACATATCTCTTGGTCAACTCAGAAAGGGCACTCTTACCATTAACTGCAACTCTTGGGTTCATTCCAAAGATGATAATCCAGAGGACAGATTTTTCTTTACAAACAAGGTCACCTCCTACTCCCTCTCTATTCATATTTGCCATCCTAAACACCATCTGGGGTGAGGCGCTGAGAGAGAAAGAGCTCCCGATTCTGCGAGGTGATGGCCATGGAGAGTGCAAAAAATTTGAAAGAATTTATGATGATGATGTCTATAATGATCTTGGAAACCCTGATGCTGATAGTAACTTATCAAGACCAGTATTAGGTGGCACGGAGTATGCATATCCGAGACGTTGCAGAACAGGTCGCCCACGCTGCAAAACAGGTCCATTATCAGAGTCGAGGAGTGATGAGATTTACCTGCCGAGGGATGAAGAATTTTCAGAG

Network for GWHGAAZE008178

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00305.20	Lipoxygenase	66	153	1.40E-34

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00454	LOX2S	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Linoleic acid metabolism	map00591
		alpha-Linolenic acid metabolism	map00592

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0016702	molecular_function	oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen
GO:0046872	molecular_function	metal ion binding
GO:0016491	molecular_function	oxidoreductase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.821
	SRR3591707	mature leaf	6.526
	SRR3591708	Shoot apex	0.138
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.264
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.085
	SRR8316896	Juvenile bud stage	0.199
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.150
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.107
	SRR6706287	Light intensity 50%	0.022
	SRR6706288	Light intensity 20%	0.058
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.080
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.125
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (diploied) 1	0.000
	CNS0095611	Silvery flower (diploied) 2	0.072
	CNS0095612	Silvery flower (diploied) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.075
CRA001975	CRR073297	Stem 1	0.178
	CRR073298	Stem 2	0.017
	CRR073299	Stem 3	0.417
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.027
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000