Gene detail

Detail information of GWHGAAZE008576

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002314847.2	4.0157E-113	hypothetical protein POPTR_0010s13100g [Populus trichocarpa]
Swissprot	tr\|D7SFH9\|GPDL2_ARATH	1E-81	Glycerophosphodiester phosphodiesterase protein kinase domain-containing GDPDL2 {ECO:0000305} (Precursor)
trEMBL	tr\|M1D0D7\|M1D0D7_SOLTU	3E-114	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400078564}
TAIR10	AT1G70250.1	2E-67	receptor serine/threonine kinase, putative

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	83319258	83319947	-
GWHAAZE00000002	mRNA	83319258	83319947	-
GWHAAZE00000002	exon	83319258	83319947	-
GWHAAZE00000002	CDS	83319258	83319947	-

Transcript Sequence
>GWHTAAZE008586 ATGACCAACGGATCCCTTGAGAAATTCGTATACGATGGAATTTCCTCAACGAATCGCCAACTGGGCTGGGATAAATCTTACTCTATTGCAATAGGCATTGCTCGAGGATTAGAGTACTTACACCGGGGCTGCAACACGCGGATTCTGCATTTCGATATAAAGCCTCAAAACATTCTTTTAGACCAAGACTATATTCCAAAGATCTCTGACTTTGGGCTTGCTAAATTATGTCCTGGTAAAGAGAGCGCTGTATCAATGTTGAACGCTAGGGGGACTATCGGTTACATTGCTCCTGAAGTATTTTGCAGAAACTTCGGACGGGTCTCTCACAAGTCAGATGTGTATAGTTACGGAATGATGGTACTAGAAATGGTTGGAGGGAGAAAGAATATCGAGGTTGAAGTTGGTCATACTAGCGAAATTTACTTTCCTGACTGGATATATAGAAAACTCGAATCGGAAGAACTTGGAATGTACGGGATTATGAACGAAGATGAAAATGTGTATGCAAGAAAGATGATAATAGTGAGCTTGTGGTGCATACAAAGCGATCCGTCAAAAAGGCCGTCTATGAGTAGAGTGGTGGAGATGTTAGAAGGGAGTTTAGAGTCTCTCGAAATCCCTCCAAAACCTGTTGTGTCTTCTCCCACACTATCACCACCACATTCTTCAACTACAGAAACAAGCTAA

Network for GWHGAAZE008576

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	5	196	1.30E-28

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_LRK10L-2

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.041
	SRR3591706	second leaf	4.797
	SRR3591707	mature leaf	23.941
	SRR3591708	Shoot apex	3.344
	SRR3591709	Stem	4.801
	SRR3591710	White floral bud	4.726
	SRR3591711	White flower	5.953
	SRR3591712	Green floral bud	6.492
	SRR3591713	Yellow flower	1.195
SRP173429	SRR8316895	Juvenile bud stage	6.374
	SRR8316896	Juvenile bud stage	10.010
	SRR8316897	Juvenile bud stage	15.968
	SRR8316894	Third green stage	4.331
	SRR8316900	Third green stage	5.154
	SRR8316901	Third green stage	5.090
	SRR8316898	Complete white stage	0.651
	SRR8316899	Complete white stage	4.957
	SRR8316903	Complete white stage	1.185
	SRR8316902	Silver flowering stage	0.476
	SRR8316904	Silver flowering stage	0.808
	SRR8316905	Silver flowering stage	0.199
	SRR8316906	Gold flowering stage	0.709
	SRR8316907	Gold flowering stage	0.507
	SRR8316908	Gold flowering stage	1.446
SRP132670	SRR6706286	Control	1.623
	SRR6706287	Light intensity 50%	1.922
	SRR6706288	Light intensity 20%	1.719
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	7.713
	CNS0095593	Slightly white alabastrum(diploid) 2	5.399
	CNS0095594	Slightly white alabastrum(diploid) 3	7.618
	CNS0095595	Whole white alabastrum(diploid) 2	4.618
	CNS0095596	Whole white alabastrum(diploid) 3	6.445
	CNS0095597	Whole white alabastrum(diploid) 4	7.333
	CNS0095598	Silvery flower (diploied) 1	5.420
	CNS0095599	Silvery flower (diploied) 2	2.774
	CNS0095600	Silvery flower (diploied) 3	1.792
	CNS0095601	Golden flower (diploid) 1	4.741
	CNS0095602	Golden flower (diploid) 2	1.524
	CNS0095603	Golden flower (diploid) 3	1.788
	CNS0095604	Slightly white alabastrum(tetraploid) 1	6.337
	CNS0095605	Slightly white alabastrum(tetraploid) 2	9.204
	CNS0095606	Slightly white alabastrum(tetraploid) 3	7.651
	CNS0095607	Whole white alabastrum(tetraploid) 1	4.428
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.447
	CNS0095609	Whole white alabastrum(tetraploid) 3	5.947
	CNS0095610	Silvery flower (diploied) 1	1.735
	CNS0095611	Silvery flower (diploied) 2	2.001
	CNS0095612	Silvery flower (diploied) 3	0.953
	CNS0095613	Golden flower (tetraploid) 1	0.967
	CNS0095614	Golden flower (tetraploid) 2	1.772
	CNS0095615	Golden flower (tetraploid) 3	0.378
CRA001975	CRR073297	Stem 1	2.061
	CRR073298	Stem 2	1.798
	CRR073299	Stem 3	1.132
	CRR073300	Leaf 1	0.651
	CRR073301	Leaf 2	0.576
	CRR073302	Leaf 3	0.897
	CRR073303	Juvenile bud 1	0.414
	CRR073304	Juvenile bud 2	0.096
	CRR073305	Juvenile bud 3	0.228
	CRR073306	Third green 1	0.062
	CRR073307	Third green 2	0.404
	CRR073308	Third green 3	0.380
	CRR073309	Second white 1	0.302
	CRR073310	Second white 2	0.211
	CRR073311	Second white 3	0.581
	CRR073312	Silver flowering 1	0.206
	CRR073313	Silver flowering 2	0.077
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	3.182
	CRR073316	Gold flowering 2	4.219
	CRR073317	Gold flowering 3	2.089
	CRR073318	Tawny withering 1	0.880
	CRR073319	Tawny withering 2	1.395
	CRR073320	Tawny withering 3	0.052