Gene detail

Detail information of GWHGAAZE009192

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009607374.1	6.17929E-29	PREDICTED: probable NOT transcription complex subunit VIP2 [Nicotiana tomentosiformis]
Swissprot	tr\|Q52JK6\|VIP2_NICBE	2E-28	Probable NOT transcription complex subunit VIP2 (Fragment)
trEMBL	tr\|M1B9C8\|M1B9C8_SOLTU	5E-29	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400040128}
TAIR10	AT1G07705.2	3E-16	NOT2 / NOT3 / NOT5 family

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	104861548	104861797	+
GWHAAZE00000002	mRNA	104861548	104861797	+
GWHAAZE00000002	exon	104861548	104861646	+
GWHAAZE00000002	exon	104861738	104861797	+
GWHAAZE00000002	CDS	104861548	104861646	+
GWHAAZE00000002	CDS	104861738	104861797	+

Transcript Sequence
>GWHTAAZE009202 ATGCGGGTCACCAACATGGAGCCTCTTGTTAAGACAAGCGGTTATGAGAGAGGATCTTACATCTGTTTCGATCCAAATACGTGGGAAACAATCCGCAAGGATAACTTTGTTCTCCATTATGAGATGTTGGAAAAAAGACCAACTCTACCTCAACATTGA

Network for GWHGAAZE009192

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04153.19	NOT2_3_5	2	43	3.60E-09

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K12605	CNOT2, NOT2	RNA degradation	map03018

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0005634	cellular_component	nucleus

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	31.844
	SRR3591706	second leaf	23.802
	SRR3591707	mature leaf	18.377
	SRR3591708	Shoot apex	42.612
	SRR3591709	Stem	34.906
	SRR3591710	White floral bud	23.053
	SRR3591711	White flower	41.947
	SRR3591712	Green floral bud	30.232
	SRR3591713	Yellow flower	45.521
SRP173429	SRR8316895	Juvenile bud stage	13.518
	SRR8316896	Juvenile bud stage	21.179
	SRR8316897	Juvenile bud stage	11.966
	SRR8316894	Third green stage	7.428
	SRR8316900	Third green stage	21.158
	SRR8316901	Third green stage	20.599
	SRR8316898	Complete white stage	8.627
	SRR8316899	Complete white stage	22.531
	SRR8316903	Complete white stage	12.513
	SRR8316902	Silver flowering stage	13.821
	SRR8316904	Silver flowering stage	17.009
	SRR8316905	Silver flowering stage	5.464
	SRR8316906	Gold flowering stage	24.858
	SRR8316907	Gold flowering stage	21.316
	SRR8316908	Gold flowering stage	29.157
SRP132670	SRR6706286	Control	6.680
	SRR6706287	Light intensity 50%	7.399
	SRR6706288	Light intensity 20%	10.541
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	36.471
	CNS0095593	Slightly white alabastrum(diploid) 2	28.734
	CNS0095594	Slightly white alabastrum(diploid) 3	30.409
	CNS0095595	Whole white alabastrum(diploid) 2	19.133
	CNS0095596	Whole white alabastrum(diploid) 3	18.494
	CNS0095597	Whole white alabastrum(diploid) 4	22.313
	CNS0095598	Silvery flower (diploied) 1	29.606
	CNS0095599	Silvery flower (diploied) 2	26.501
	CNS0095600	Silvery flower (diploied) 3	25.592
	CNS0095601	Golden flower (diploid) 1	24.208
	CNS0095602	Golden flower (diploid) 2	30.038
	CNS0095603	Golden flower (diploid) 3	29.315
	CNS0095604	Slightly white alabastrum(tetraploid) 1	23.719
	CNS0095605	Slightly white alabastrum(tetraploid) 2	28.067
	CNS0095606	Slightly white alabastrum(tetraploid) 3	36.667
	CNS0095607	Whole white alabastrum(tetraploid) 1	25.381
	CNS0095608	Whole white alabastrum(tetraploid) 2	22.965
	CNS0095609	Whole white alabastrum(tetraploid) 3	25.134
	CNS0095610	Silvery flower (diploied) 1	31.232
	CNS0095611	Silvery flower (diploied) 2	31.657
	CNS0095612	Silvery flower (diploied) 3	36.346
	CNS0095613	Golden flower (tetraploid) 1	34.224
	CNS0095614	Golden flower (tetraploid) 2	35.897
	CNS0095615	Golden flower (tetraploid) 3	28.965
CRA001975	CRR073297	Stem 1	11.599
	CRR073298	Stem 2	9.689
	CRR073299	Stem 3	5.150
	CRR073300	Leaf 1	7.977
	CRR073301	Leaf 2	10.951
	CRR073302	Leaf 3	5.830
	CRR073303	Juvenile bud 1	8.434
	CRR073304	Juvenile bud 2	4.909
	CRR073305	Juvenile bud 3	9.474
	CRR073306	Third green 1	3.092
	CRR073307	Third green 2	4.211
	CRR073308	Third green 3	6.252
	CRR073309	Second white 1	10.736
	CRR073310	Second white 2	10.117
	CRR073311	Second white 3	12.724
	CRR073312	Silver flowering 1	11.262
	CRR073313	Silver flowering 2	12.134
	CRR073314	Silver flowering 3	9.378
	CRR073315	Gold flowering 1	13.392
	CRR073316	Gold flowering 2	23.237
	CRR073317	Gold flowering 3	8.629
	CRR073318	Tawny withering 1	10.511
	CRR073319	Tawny withering 2	12.764
	CRR073320	Tawny withering 3	18.430