Gene detail

Detail information of GWHGAAZE010092

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KEH15194.1	0	ATP synthase, F1 beta subunit [Medicago truncatula]
Swissprot	tr\|Q8MBM3\|ATPB_CONAR	6E-124	ATP synthase subunit beta, chloroplastic {ECO:0000255\|HAMAP-Rule:MF_01347}
trEMBL	tr\|A0A072TC88\|A0A072TC88_MEDTR	0	ATP synthase, F1 beta subunit {ECO:0000313\|EMBL:KEH15194.1}
TAIR10	ATCG00480.1	3E-100	ATP synthase subunit beta

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	123349623	123350643	-
GWHAAZE00000002	mRNA	123349623	123350643	-
GWHAAZE00000002	exon	123349623	123349972	-
GWHAAZE00000002	exon	123350085	123350643	-
GWHAAZE00000002	CDS	123350085	123350643	-
GWHAAZE00000002	CDS	123349623	123349972	-

Transcript Sequence
>GWHTAAZE010104 ATGCCTTCCGCTGTGGGTTATCAACCTACCCTTAGTACCGAAATGGGTACTTTACAAGAAAGAATTACTTCTACCAAGAAGGGGTCCATAACTTCTATTCAAGCGGTTTATGTCCCTGCAGACGATTTGACCGACCCTGCTCCTGCTACGACATTTGCACATTTAGATGCTACTACCGTACTATCAAGAGGATTGGCCGCCAAGGGTATCTATCCAGCAGTAGATCCTTTAGATTCAACGTCAACTATGCTACAACCTGGGATCGTTGGTAAGAACCATTATGAAACAGCGCAAAGGGTTAAGGAAACTTTACAACGTTACAAAGAACTTCAGGACATTATAGCTATCCTTGGGTTGGACGAATTATCCGAAGAGGATCGTTTAACCGTAGCAAGAGCACGAAAAATTGAGCGTTTCTTATCACAACCTTTTTTTGTAGCAGAAGTATTTACCGGTTCTCCAGGGAAATATGTTGGTCTAACAGAAACAATTAGAGGGTTTCAATTGATCCTTTCCGGAGAATTAGATGTTCTTCCCGAACAGGCCTTTTATTTGGTAGAAGTGAAAGAAAGAATTTTATCTACTAATAGTGGCCAAATTGGCGTATTACCAAATCACGCCCCTATTGCCACAGCTGTCGATATAGGTATTTTGAGAATACGCCTTAACGACCAATGGGTAACGATGGCTCTGATGGGTGGTTTTGCTAGAATAGGTAATAATGAGATCACTGTTTTAGTAAATAATGCGGAAAAGAGTAGTGACATTGATCCACACGAAGCTCAGCAAACTCTTGAAATAGCGGAAGCTGGTTTGAGAAAAGCTGAAGGAAAAAGACAAACAATTGAGGCAAATCTAGCCCTCCGACGAGCTAGGACACGAGTAGAGACTATCAGGGCGATTTCATAA

Network for GWHGAAZE010092

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00006.26	ATP-synt_ab	1	81	2.80E-20
PF02823.17	ATP-synt_DE_N	177	250	4.40E-19
PF00401.21	ATP-synt_DE	255	297	3.10E-06

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02112	ATPF1B, atpD	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Photosynthesis	map00195

Gene Ontology

GO term	Ontology	Name
GO:0015986	biological_process	ATP synthesis coupled proton transport
GO:0045261	cellular_component	proton-transporting ATP synthase complex, catalytic core F(1)
GO:0046933	molecular_function	proton-transporting ATP synthase activity, rotational mechanism
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.125
	SRR3591706	second leaf	0.386
	SRR3591707	mature leaf	0.742
	SRR3591708	Shoot apex	0.329
	SRR3591709	Stem	0.081
	SRR3591710	White floral bud	0.090
	SRR3591711	White flower	0.085
	SRR3591712	Green floral bud	0.099
	SRR3591713	Yellow flower	0.203
SRP173429	SRR8316895	Juvenile bud stage	2.957
	SRR8316896	Juvenile bud stage	0.892
	SRR8316897	Juvenile bud stage	4.780
	SRR8316894	Third green stage	3.640
	SRR8316900	Third green stage	0.404
	SRR8316901	Third green stage	0.311
	SRR8316898	Complete white stage	1.104
	SRR8316899	Complete white stage	0.178
	SRR8316903	Complete white stage	0.861
	SRR8316902	Silver flowering stage	1.509
	SRR8316904	Silver flowering stage	1.398
	SRR8316905	Silver flowering stage	1.171
	SRR8316906	Gold flowering stage	0.210
	SRR8316907	Gold flowering stage	0.149
	SRR8316908	Gold flowering stage	0.164
SRP132670	SRR6706286	Control	0.032
	SRR6706287	Light intensity 50%	0.112
	SRR6706288	Light intensity 20%	0.067
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.342
	CNS0095593	Slightly white alabastrum(diploid) 2	1.181
	CNS0095594	Slightly white alabastrum(diploid) 3	1.390
	CNS0095595	Whole white alabastrum(diploid) 2	1.272
	CNS0095596	Whole white alabastrum(diploid) 3	1.010
	CNS0095597	Whole white alabastrum(diploid) 4	1.277
	CNS0095598	Silvery flower (diploied) 1	0.692
	CNS0095599	Silvery flower (diploied) 2	0.791
	CNS0095600	Silvery flower (diploied) 3	0.353
	CNS0095601	Golden flower (diploid) 1	0.847
	CNS0095602	Golden flower (diploid) 2	0.396
	CNS0095603	Golden flower (diploid) 3	0.468
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.624
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.600
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.586
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.096
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.068
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.476
	CNS0095610	Silvery flower (diploied) 1	0.314
	CNS0095611	Silvery flower (diploied) 2	0.457
	CNS0095612	Silvery flower (diploied) 3	0.332
	CNS0095613	Golden flower (tetraploid) 1	0.456
	CNS0095614	Golden flower (tetraploid) 2	0.270
	CNS0095615	Golden flower (tetraploid) 3	0.316
CRA001975	CRR073297	Stem 1	1.746
	CRR073298	Stem 2	2.181
	CRR073299	Stem 3	0.894
	CRR073300	Leaf 1	0.582
	CRR073301	Leaf 2	1.177
	CRR073302	Leaf 3	0.536
	CRR073303	Juvenile bud 1	0.949
	CRR073304	Juvenile bud 2	0.620
	CRR073305	Juvenile bud 3	1.705
	CRR073306	Third green 1	0.806
	CRR073307	Third green 2	1.176
	CRR073308	Third green 3	0.957
	CRR073309	Second white 1	1.391
	CRR073310	Second white 2	2.302
	CRR073311	Second white 3	3.247
	CRR073312	Silver flowering 1	2.196
	CRR073313	Silver flowering 2	0.937
	CRR073314	Silver flowering 3	0.751
	CRR073315	Gold flowering 1	13.343
	CRR073316	Gold flowering 2	11.370
	CRR073317	Gold flowering 3	21.508
	CRR073318	Tawny withering 1	1.064
	CRR073319	Tawny withering 2	0.246
	CRR073320	Tawny withering 3	0.759