Gene detail

Detail information of GWHGAAZE010095

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ADD31105.1	8.8198E-157	clp protease proteolytic subunit protein (chloroplast) [Lonicera japonica]
Swissprot	tr\|P12210\|CLPP_TOBAC	1E-77	ATP-dependent Clp protease proteolytic subunit {ECO:0000255\|HAMAP-Rule:MF_00444}
trEMBL	tr\|D3WBN4\|D3WBN4_LONJA	3E-157	ATP-dependent Clp protease proteolytic subunit {ECO:0000256\|RuleBase:RU003567}
TAIR10	ATCG00670.1	2E-53	plastid-encoded CLP P

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	123393707	123394357	-
GWHAAZE00000002	mRNA	123393707	123394357	-
GWHAAZE00000002	exon	123393707	123394357	-
GWHAAZE00000002	CDS	123393707	123394357	-

Transcript Sequence
>GWHTAAZE010107 ATGCCTGTAGGTGTTCCAAAAATACCCTTTCAAATTTCTGGAGACGAAGAAGCGTCTTGGGTTGACGTATACAACGGACTTTATCGAAGGGGATTCCTTTTTATAGTCCAAGAGATTGATACCGAACTCTCAAATCAAATTGTAGGTCTTATGGTATTTCTCAGTTTGGAGGGTGAGGTAAACGATCTGTATTTCTTTATATCCTCTCTCGGCGGATCCATGGTAGATGGATTCGCTATTTTTGATATGCTGGTATATTTGCCACCAACGATGCATACATTGAGTATCGGAGAATGCGCCTCAATGGCATCTTTGATCGTGGCCGGAGGAACATTTACCCAACGTATAGCATTCCCTCACAGTAGGATAATGATCCATCAACCTAATACTTTTCCTTTTGAGACACCAACGGGAGAAACTTTCCTCGAAATAAAGGAATTCTGTCGCCTGCGTGCGTTGGTCGGAGAGGCTTATGCAAAAATAACGGGCCAACCCCTTTGGGTTGTAGAGATAGACCTGGAAAGAGATATTTTTATGTCAGCACAAGAAGCCAAAGATTATGGAATTGTTGATCTTGTAGCGAGTGGCAAGCTTGAATTTCGTCAAAACCCGAGTGTGCGCAAGCGGCCATTTGAGATTTTCCCTTCTTAA

Network for GWHGAAZE010095

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00574.24	CLP_protease	17	194	2.80E-48

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01358	clpP, CLPP	Cell cycle - Caulobacter	map04112
K01358	clpP, CLPP	Longevity regulating pathway - worm	map04212

Gene Ontology

GO term	Ontology	Name
GO:0006508	biological_process	proteolysis
GO:0004252	molecular_function	serine-type endopeptidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.186
	SRR3591706	second leaf	1.125
	SRR3591707	mature leaf	1.365
	SRR3591708	Shoot apex	1.483
	SRR3591709	Stem	0.781
	SRR3591710	White floral bud	1.710
	SRR3591711	White flower	0.565
	SRR3591712	Green floral bud	0.703
	SRR3591713	Yellow flower	0.759
SRP173429	SRR8316895	Juvenile bud stage	7.074
	SRR8316896	Juvenile bud stage	4.025
	SRR8316897	Juvenile bud stage	10.967
	SRR8316894	Third green stage	12.179
	SRR8316900	Third green stage	1.451
	SRR8316901	Third green stage	1.211
	SRR8316898	Complete white stage	3.840
	SRR8316899	Complete white stage	0.509
	SRR8316903	Complete white stage	3.008
	SRR8316902	Silver flowering stage	6.134
	SRR8316904	Silver flowering stage	4.284
	SRR8316905	Silver flowering stage	5.046
	SRR8316906	Gold flowering stage	2.106
	SRR8316907	Gold flowering stage	0.840
	SRR8316908	Gold flowering stage	1.958
SRP132670	SRR6706286	Control	0.685
	SRR6706287	Light intensity 50%	0.841
	SRR6706288	Light intensity 20%	0.920
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.802
	CNS0095593	Slightly white alabastrum(diploid) 2	3.833
	CNS0095594	Slightly white alabastrum(diploid) 3	2.912
	CNS0095595	Whole white alabastrum(diploid) 2	6.054
	CNS0095596	Whole white alabastrum(diploid) 3	3.461
	CNS0095597	Whole white alabastrum(diploid) 4	3.948
	CNS0095598	Silvery flower (diploied) 1	4.318
	CNS0095599	Silvery flower (diploied) 2	3.129
	CNS0095600	Silvery flower (diploied) 3	2.164
	CNS0095601	Golden flower (diploid) 1	2.628
	CNS0095602	Golden flower (diploid) 2	1.511
	CNS0095603	Golden flower (diploid) 3	1.883
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.807
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.172
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.920
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.729
	CNS0095608	Whole white alabastrum(tetraploid) 2	4.751
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.245
	CNS0095610	Silvery flower (diploied) 1	1.947
	CNS0095611	Silvery flower (diploied) 2	1.255
	CNS0095612	Silvery flower (diploied) 3	1.673
	CNS0095613	Golden flower (tetraploid) 1	3.028
	CNS0095614	Golden flower (tetraploid) 2	1.334
	CNS0095615	Golden flower (tetraploid) 3	2.286
CRA001975	CRR073297	Stem 1	5.122
	CRR073298	Stem 2	6.892
	CRR073299	Stem 3	2.547
	CRR073300	Leaf 1	4.004
	CRR073301	Leaf 2	2.618
	CRR073302	Leaf 3	2.970
	CRR073303	Juvenile bud 1	5.586
	CRR073304	Juvenile bud 2	3.829
	CRR073305	Juvenile bud 3	7.457
	CRR073306	Third green 1	4.631
	CRR073307	Third green 2	3.264
	CRR073308	Third green 3	5.259
	CRR073309	Second white 1	3.579
	CRR073310	Second white 2	13.748
	CRR073311	Second white 3	20.173
	CRR073312	Silver flowering 1	19.795
	CRR073313	Silver flowering 2	5.444
	CRR073314	Silver flowering 3	7.560
	CRR073315	Gold flowering 1	18.311
	CRR073316	Gold flowering 2	14.808
	CRR073317	Gold flowering 3	13.350
	CRR073318	Tawny withering 1	3.123
	CRR073319	Tawny withering 2	3.441
	CRR073320	Tawny withering 3	2.739